Skip to content

Advertisement

  • Research
  • Open Access

Effect of CD14/TLR4 antagonist on GnRH/LH secretion in ewe during central inflammation induced by intracerebroventricular administration of LPS

Journal of Animal Science and Biotechnology20189:52

https://doi.org/10.1186/s40104-018-0267-8

©  The Author(s). 2018

  • Received: 27 December 2017
  • Accepted: 17 May 2018
  • Published:

Abstract

Background

Immune stress induced by lipopolysaccharide (LPS) influences the gonadotropin-releasing hormone (GnRH)/luteinizing hormone (LH) secretion. Presence of LPS interacting Toll-like receptor (TLR) 4 in the hypothalamus may enable the direct action of LPS on the GnRH/LH secretion. So, the aim of the study was to investigate the influence of intracerebroventricular (icv) injection of TLR4 antagonist on GnRH/LH secretion in anestrous ewes during LPS-induced central inflammation. Animals were divided into three groups icv-treated with: Ringer-Locke solution, LPS and TLR4 antagonist followed by LPS.

Results

It was demonstrated that TLR4 antagonist reduced LPS-dependent suppression of GnRH gene expression in the preoptic area and in the medial basal hypothalamus, and suppression of receptor for GnRH gene expression in the anterior pituitary gland. It was also shown that TLR4 antagonist reduced suppression of LH release caused by icv injection of LPS. Central administration of LPS stimulated TLR4 gene expression in the medial basal hypothalamus.

Conclusions

It was indicated that blockade of TLR4 prevents the inhibitory effect of centrally acting LPS on the GnRH/LH secretion. This suggests that some negative effects of bacterial infection on the hypothalamic-pituitary-gonadal axis activity at the hypothalamic level may be caused by central action of LPS acting through TLR4.

Keywords

  • Ewe
  • GnRH
  • LH
  • LPS
  • TLR4 antagonist

Background

It is stated that bacterial and viral infections affect female reproductive system, causing disturbances in the secretory activity of the hypothalamic-pituitary-gonadal (HPG) axis, consequently leading to many reproductive dysfunctions, ranging from ovulation cycle disorders to even complete infertility [1, 2]. It is considered that the suppression of the HPG axis activity during bacterial infection may result from direct and indirect effect of bacterial endotoxin – lipopolysaccharide (LPS) [3].

Bacterial endotoxin is a principal pathogenic component of outer membrane Gram-negative bacterial cell walls and it is recognized by immune system cells as a signal of danger. LPS is released from the surface of replicating or dying bacteria into the circulation and plays a key role in the pathophysiology of infectious diseases [4]. LPS induces cellular responses through Toll-like receptor (TLR) 4, that plays a crucial role in the activation of innate immunity and pathogen recognition [5, 6]. Animal cells are stimulated by LPS through signaling cascades with several specific proteins like cluster of differentiation (CD) 14 protein, myeloid differentiation factor 2 (MD-2) and LPS-binding protein (LBP), a necessary component of TLR4 [7, 8]. Endotoxin forms a complex with LBP, and then, this complex binds to CD14, which plays a pivotal role in TLR4 receptor activation [9, 10]. Thus, in collaboration with these proteins, TLR4 is activated and can conduct its inflammatory signal through the system of intracellular pathways, which ultimately leads to activation of some transcription factors or induces apoptosis [11, 12].

Due to its immunogenic activity, bacterial endotoxin is commonly used in experimental models of animal and human infections. Peripheral administration of LPS triggers a cascade of cytokines and prostaglandins to induce a wide variety of pathophysiological responses, activation of the hypothalamic-pituitary-adrenal (HPA) axis [13] and inhibition of the HPG axis [14]. It is proven, that bacterial endotoxin exerts an inhibitory effect on the reproductive system at the level of hypothalamus by altering the gonadotropin-releasing hormone (GnRH) secretion [1] and at the level of anterior pituitary gland (AP) [15] by inhibiting both, the pulsatile release of luteinizing hormone (LH) and the LH surge [16, 17]. It is postulated that the immune and neuroendocrine systems may communicate with each other through the action of the pro-inflammatory mediators – cytokines, molecules synthesized by the cells belonging to these two systems [13, 18, 19]. It was shown that LPS given intra-arterially increased plasma concentration of pro-inflammatory cytokines including interleukin (IL)-1β, IL-6 and tumor necrosis factor (TNF) α [20]. Moreover, it was reported that peripherally administered LPS also raised the level of the above-mentioned pro-inflammatory cytokines present in the mammalian cerebrospinal fluid (CSF) during inflammation [21, 22]. The origin of these pro-inflammatory cytokines in the central nervous system (CNS) seems to be differentiated: the peripheral cytokines can cross the blood-brain barrier (BBB) through fenestrated brain capillaries in the choroid plexus (CP), the organum vasculosum of the lamina terminalis, the median eminence (ME), the subfornical organ and the area postrema [23]. In the recent study it is suggested that CP may play a significant role in the transition of the inflammatory signal into the brain parenchyma. It was found that the cells of the CP express all TLRs genes except TLR8. So it can be suggested that this structure has a potential to sense the presence of many bacterial and viral components [24]. Moreover, it was reported that in response to peripheral bacterial endotoxin stimulation, pro-inflammatory cytokines could be synthesized by macrophage-like cells in the circumventricular organs and the CP [25]. The cytokines may also be transported into the brain via the BBB by saturated, self-inhibitable transport mechanism [23]. However, significant sources of central pro-inflammatory cytokines may generate their own synthesis within the brain tissue including hypothalamus [26–28]. Centrally acting pro-inflammatory cytokines may disturb the HPG axis activity by affecting the secretion of GnRH in the hypothalamus. In the previous studies it was shown that IL-1β, acting at the hypothalamic level, is a potent negative regulator of the HPG axis activity both in rat [29] and sheep [30]. Furthermore, the important role of central pro-inflammatory cytokines in the mediation of suppressory effect of LPS-treatment on the secretion of GnRH/LH is proven in the studies where the inhibition of synthesis of these mediators in the hypothalamus reduced the inhibition of the HPG axis activity [31, 32].

However, it was previously reported that LPS interacting TLR4 receptors are widespread in the neuroendocrine tissues including the hypothalamus and the AP [33–36]. TLRs are present in the brain, where their expression is believed to be limited to glial cells (microglia, astrocytes, and oligodendrocytes [37]. Thus, it cannot be excluded that LPS action on the activity of reproductive axis may also have direct character. In our previous study it was shown that LPS may directly affect the secretory activity of the pituitary gland. It has been found that endotoxin affects beta subunit of luteinizing hormone (LH-β) gene expression in the ex-vivo AP explants [38]. However, there is some evidence that LPS may also influence the HPG activity acting at the hypothalamic level. It was found that the influx of some quantities of endotoxin through the BBB occurs during inflammation. The measurable amount of iodine-radiolabelled LPS crossing the BBB and reaching the brain parenchyma was demonstrated in rats [39] and mice [40]. The latest results from Vargas-Caraveo et al. [41], suggest that LPS infiltrates in the brain in physiological conditions, possibly through a lipoprotein transport mechanism, and it is bound to its receptors in blood-brain interfaces. This fact suggests that the neuroinflammation caused by immune stress may be induced not only by pro-inflammatory cytokines crossing the BBB but also by the direct action of LPS reaching the CNS. It is known that neuroinflammatory processes may negatively influence the GnRH/LH secretion, therefore the central action of LPS could be involved in the suppression of HPG axis activity. It could be assumed that activation of the TLR4 signaling pathway in the hypothalamus plays an important role in this process.

The research hypothesis assumes that acting centrally bacterial endotoxin inhibits the GnRH/LH secretion in ewes and that blockade of TLR4 using CD14/TLR4 antagonist in the hypothalamus would reduce this suppressory action of LPS.

The aim of this study was to investigate the influence of intracerebroventricular (icv) injection of CD14/TLR4 antagonist on GnRH/LH secretion in anestrous ewes during central inflammation induced by icv administration of LPS.

Methods

Animals

The study was performed on 18 adult, 3-year-old Blackhead ewes in the anestrous season (April-May). All animals were in good condition (body condition score of 3 in a 5-point scale). The animals were maintained indoors in individual pens and exposed to natural daylight. The ewes were well adapted to the experimental conditions; always had visual contact with their neighbors even during the experimental period, to prevent the stress of social isolation. The animals were fed a constant diet of commercial concentrates with hay and water available ad libitum. One month before the start of the experiment all groups of ewes were cannulated with stainless steel guide cannulas (1.2 mm o.d.) into the third ventricle under stereotaxic control [42]. The guide cannula was fixed to the skull with stainless steel screws and dental cement. The correct placement of the guide cannula into the third ventricle was established by the efflux of the CSF from cannula during the surgery. Additionally, the placement of the cannula was checked by inspection of the brain after decapitation. All animals had a venous catheters implanted into jugular vein the day before the experiment. All procedures were performed with the consent of the Local Ethics Committee of Warsaw University of Life Sciences – SGGW, resolution No. 22/2013 of 22 May 2013.

Experimental procedures

The animals (n = 18) were randomly assigned to three experimental groups: (1) control group (n = 6) that received icv injection of vehicle solution (150 μL/animal) containing 143 μL Ringer Locke solution (RLs) and 7 μL dimethyl sulfoxide (DMSO)/ethanol (1 vol: 1 vol) into the third ventricle of the brain; (2) LPS group (n = 6) that received icv injection of LPS from E.coli 055:B5 (Sigma Aldrich, St. Louis, MO, USA) solution (250 μg LPS dissolved in 150 μL vehicle solution/animal); (3) anti-TLR4 group (n = 6) that received icv injection of CD14/TLR4 antagonist IAXO-101 (Innaxon, Tewkesbury, UK) solution (150 μL/animal) consisting of 143 μL RLs and 7 μL 2 mmol/L stock solution of IAXO-101 (5 mg IAXO-101 dissolved in 3,085 μL DMSO/ethanol (1 vol: 1 vol) and 30 min later LPS solution (250 μg LPS dissolved in 150 μL vehicle solution/animal). IAXO-101 is a synthetic CD14/TLR4 antagonist modulating TLR4 activities in vitro, described to interfere with human, rat and mouse TLR4/CD14 signaling. The efficiency of the LPS treatment to induce an inflammatory response in the animal was estimated basing on the measurement of the body temperature. In all LPS treated animals the increase of body temperaturę was observed, while in CD14/TLR4 treated animals there was a complete suppression of LPS-induced fever (data not shown).Jugular blood samples from each ewe were taken for LH and cortisol measurement at 15 min intervals, beginning 2 h before and continuing 3 h after icv administration of reagents or control vehicle. The animals were euthanized immediately after the experiment (3 h after icv administration of reagents or vehicle), the brains were rapidly removed from the skulls and then chosen hypothalamic structures such as preoptic area (POA), anterior hypothalamus (AHA), medial basal hypothalamus (MBH) and median eminence (ME) and APs were dissected. All tissues were frozen immediately after collection in liquid nitrogen and were stored in − 80 °C until assay.

Assays

Radioimmunoassay for plasma hormones (LH and cortisol)

The concentration of LH in plasma was assayed by the radioimmunoassay (RIA) double antibody method using anti-ovine-LH and anti-rabbit-γ-globulin antisera and ovine standard (teri.oLH; Tucker Endocrine Research Institute, Atlanta, GA, USA) as described by Stupnicki and Madej [43]. The sensitivity was 0.3 ng/mL; intra- and interassay coefficients of variation were 8.3% and 12.5%, respectively.

The cortisol concentrations were determined by the RIA method according to Kokot and Stupnicki [44], using rabbit anticortisol antisera (R/75) and HPLC grade cortisol standard (Sigma-Aldrich, Saint Louis, MI, USA). The assay sensitivity was 0.95 ng/mL and the intra- and interassay coefficients of variation were 10% and 12%, respectively.

Relative gene expression assays

Total RNA from hypothalamic and pituitary tissues was isolated using NucleoSpin RNA II Kit (MACHEREY-NAGEL Gmbh & Co Düren, Germany) according to manufacturer’s instructions. The purity and concentration of isolated RNA were quantified spectrophotometrically by measuring the optical density at 260 and 280 nm in the NanoDrop 1000 instrument (Thermo Fisher Scientific Inc., Waltham, USA). The RNA integrity was verified by electrophoresis using 1% agarose gel stained with ethidium bromide. Maxima First Strand cDNA synthesis Kit for RT-qPCR (Thermo Fisher Scientific Inc., Waltham, USA) was used to prepare cDNA synthesis. As a starting material for this PCR synthesis 2 μg of total RNA was used.

Real-time RT-PCR was performed using HOT FIREPol EvaGreen® qPCR Mix Plus (Solis BioDyne, Tartu, Estonia) and HPLC-grade oligonucleotide primers (Genomed, Warsaw, Poland). The primer sequences were designed using Primer 3 software (Table 1). One reaction mixture (in total 20 μL) contained: 4 μL of PCR Master Mix (5×), 14 μL of RNase-free water, 1 μL of primers (0.5 μL each primer, working concentration 0.25 μmol) and 1 μL of the cDNA template. The reactions were run on the Rotor-Gene 6000 instrument (Qiagen, Düsseldorf, Germany) with the following protocol was used: 95 °C for 15 min and 30 cycles of 95 °C for 10 s for denaturation, 60 °C for 20 s for annealing, and 72 °C for 10 s for extension. After the cycles, a final melting curve analysis under continuous fluorescence measurements was performed to confirm the specificity of the amplification.
Table 1

Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interests

Gene

GenBank Acc. No.

Amplicon Size, bp

Sequence (5′ → 3′)

Forward

Reverse

GAPDH a

NM_001034034

134

AGAAGGCTGGGGCTCACT

GGCATTGCTGACAATCTTGA

ACTB b

U39357

168

CTTCCTTCCTGGGCATGG

GGGCAGTGATCTCTTTCTGC

PPIC c

NM_001076910

131

ACGGCCAAGGTCTTCTTTG

TATCCTTTCTCTCCCGTTGC

GnRH d

U02517

123

GCCCTGGAGGAAAGAGAAAT

GAGGAGAATGGGACTGGTGA

GnRH-R e

NM_001009397

150

TCTTTGCTGGACCACAGTTAT

GGCAGCTGAAGGTGAAAAAG

TLR4 fg

AY957615

117

GGTTCCCAGAACTGCAAGTG

GGATAGGGTTTCCCGTCAGT

IL-1β h

X54796.1

137

CAGCCGTGCAGTCAGTAAAA

GAAGCTCATGCAGAACACCA

References: a[28]; b[28]; c[28]; d[73]; e[73]; f[34]; g[74]; h[28]

Relative gene expression was calculated using the comparative quantification option of the RotorGene 6000 software 1.7 (Qiagen, Düsseldorf, Germany). Three housekeeping genes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin (ACTB), and cyclophilin C (PPIC) were tested. The BestKeeper was used to determine the most stable housekeeping gene for normalizing genes of interest expression. The BestKeeper was based on the pair-wise correlation analysis of all pairs of candidate genes [45] and calculated variations of all reference genes (SD ± Ct). GAPDH was chosen as the best endogenous control gene. It was characterized by the lowest SD ± Ct value and a good correlation coefficient with the remaining analyzed housekeeping genes. The results are presented as relative gene expression of the target gene versus housekeeping gene, and relative expression value and mean ± SEM. The average relative quantity of gene expression in control groups was set to 1.0.

ELISA assay for the GnRH concentration in the ME

Concentrations of GnRH in the ME were determined with a commercial GnRH ELISA kit dedicated for sheep (CUSABIO BIOTECH Co., Ltd., China). All steps in the assays were performed according to the manufacturer’s instructions as described by Herman et al. [32]. Shortly, the ME tissues were homogenized in 400 µL of phosphate buffered saline (0.02 mol). Then homogenates were subjected to two freeze-thaw cycles to further break the cell membranes. After that, the homogenates were centrifuged for 15 min at 1,500 × g in 4 °C. The incubation of plates and absorbance measurement at 450 nm were performed using a VersaMax reader (Molecular Devices, Sunnyvale, CA, USA). The assay sensitivity was 1.0 pg/mL. GnRH concentrations were normalized against the total protein content in each sample, assayed using the Bradford method [46].

Statistical data analysis

All data are expressed as mean ± SEM. The results of blood hormones concentration obtained only after treatment period (from +1 h to +3 h after icv administration), GnRH content in the ME and all examined genes expression were subjected to a one-way ANOVA analysis. Before ANOVA was conducted its two assumptions were checked: normality (Shapiro-Wilk’s test) and homogeneity of the variances (Levene’s test). When a existence of interaction between factors was observed, a post hoc analysis using Tukey’s test was conducted to identify treatment effects. Statistical significance was defined as P < 0.05.

The statistical analysis was performed using STATISTICA software (Stat-Soft, Inc., Tulsa, OK, USA).

Results

Effect of icv administration of CD14/TLR4 antagonist on plasma hormones release during central inflammation induced by icv administration of LPS

Centrally administered LPS decreased (P < 0.05) plasma LH concentration in comparison with control group. Treatment with CD14/TLR4 antagonist reduced the inhibitory effect of LPS on LH release (Fig. 1a). LPS administration (icv) significantly (P < 0.05) increased plasma cortisol level and treatment with CD14/TLR4 antagonist prevented the influence of LPS (Fig. 2).
Fig. 1
Fig. 1

Mean (± SEM) concentration of plasma LH (panel A) and GnRH in the ME (panel B) after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Fig. 2
Fig. 2

Mean (± SEM) concentration of plasma cortisol after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Effect of icv administration of CD14/TLR4 antagonist on GnRH synthesis in the ME during central inflammation induced by icv administration of LPS

Centrally administered LPS decreased (P < 0.05) GnRH concentration in the ME as compared with control group. Treatment with CD14/TLR4 antagonist did not prevent the inhibitory effect of LPS on GnRH level (Fig. 1b).

Effect of icv administration of LPS and CD14/TLR4 antagonist on IL-1β gene expression in the hypothalamus

Centrally administered LPS significantly increased (P < 0.05) IL-1β gene expression in the POA and in the MBH as compared with the control group. The central administration of CD14/TLR4 antagonist significantly (P < 0.05) reduced LPS dependent increase of GnRH gene expression in comparison with LPS group in these structures (Fig. 3).
Fig. 3
Fig. 3

Mean (± SEM) relative IL-1 β mRNA in hypothalamic structures POA and MBH after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b, c) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Effect of icv administration of CD14/TLR4 antagonist on GnRH and GnRH-R genes expression during central inflammation induced by icv administration of LPS

GnRH and GnRH-R genes expressions were determined in four hypothalamic structures: POA, AHA, MBH and the ME. Icv injection of LPS significantly (P < 0.05) decreased GnRH gene expression in the POA and in the MBH as compared with the control group. The central administration of CD14/TLR4 antagonist significantly (P < 0.05) reduced LPS dependent suppression of GnRH gene expression in comparison with LPS group in these structures. In the ME gene expression of GnRH was significantly increased (P < 0.05) in anti-TLR4 group versus the control group (Fig. 4).
Fig. 4
Fig. 4

Mean (± SEM) relative GnRH mRNA expression in four hypothalamic structures (POA, AHA, MBH, ME) after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Gene expression of receptor for GnRH was determined only in the ME and in the AP, because the amount of GnRH-R mRNA determined in the other examined hypothalamic structures (POA, AHA, MBH) was too low and so the quantitative analysis in these structures was enabled to be performed. Central injection of LPS significantly (P < 0.05) decreased GnRH-R mRNA level in the ME and in the AP in comparison with the control group. The central administration of CD14/TLR4 antagonist significantly (P < 0.05) reduced LPS dependent suppression of GnRH-R gene expression only in the AP (Fig. 5).
Fig. 5
Fig. 5

Mean (± SEM) relative GnRH-R mRNA expression in the ME and in the AP after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Effect of icv administration of CD14/TLR4 antagonist on TLR4 gene expression during central inflammation induced by icv administration of LPS

TLR4 gene expression was detected in four analyzed hypothalamic structures POA, AHA, MBH and the ME. Central injection of LPS and CD14/TLR4 antagonist with LPS increased (P < 0.05) TLR4 mRNA level in the MBH as compared with the control group (Fig. 6).
Fig. 6
Fig. 6

Mean (± SEM) relative TLR4 mRNA expression in four hypothalamic structures (POA, AHA, MBH, ME) after icv administration of CD14/TLR4 antagonist during central inflammation induced by icv administration of LPS. Different lowercase letters (a, b) indicate significant differences between groups at P < 0.05 (one-way ANOVA followed by Tukey’s post hoc test)

Discussion

Our study demonstrated that icv LPS administration elevated local synthesis of IL-1β in the hypothalamus of anestrous sheep and central administration of CD14/TLR4 antagonist reduces this stimulatory effect of LPS. The increased IL-1β gene expression testify the existence of inflammatory process in the hypothalamus. The stimulation of this cytokine gene expression in the hypothalamus of anestrous ewes was also described during peripheral inflammatory challenge triggered by intra venous LPS injection [27].

In our study it was demonstrated that centrally administered bacterial endotoxin could inhibit the secretion of GnRH directly at the hypothalamic level acting primary through its TLR4. It was found that icv administration of LPS reduced the level of GnRH mRNA in the hypothalamic structures such as the POA and MBH. However, the blockade of the TLR4 in the hypothalamus by administering its antagonist prior to icv injection of LPS, prevented lowering of the GnRH gene expression in these structures but not in ME.

Moreover, it was determined that centrally acting LPS reduced the accumulation of GnRH peptide in the ME, where most (in sheep approximately 70%) of GnRH-ergic neuron terminals are located [47]. Neuropeptide GnRH is generally synthesized in the neuronal cells bodies located mainly in the POA and in a certain amount also in other hypothalamic structures such as MBH, and after synthesis is transported to the nerves terminals in the ME and there is stored till release. It is released into the capillaries of the hypothalamic-pituitary portal system in a pulsatile manner. This decapeptide is transported with blood to the gonadotrophes in the AP and regulates secretion of gonadotropins [48]. It has been shown that increased synthesis and accumulation of GnRH in the ME leads to increased pulse frequency, which is a main factor leading to pre-ovulatory discharge of gonadotropins, and therefore an important element of positive feedback [49]. Therefore, LPS-dependent reduction of the GnRH accumulation in the ME may exert a profound negative effect on this peptide release and downstream LH secretion. However, mRNA encoding GnRH seems to be not synthesized directly in the ME but it is speculated that this mRNA is transported to the ME from the other hypothalamic structures. The physiological roles of this mRNA as well as the mechanisms regulating its transport to the ME are not well understood. It is considered that this local GnRH mRNA may support the secretion of GnRH from the nerves terminals but this issue has not been proved yet. Therefore the amount of GnRH peptide does not have to reflect the changes in the level of GnRH mRNA in this structure. This may be the reason for the lack of parallelism the results concerning changes in mRNA GnRH and concentration of GnRH peptide in ME in anti TLR4 group. The present results showing that blockade of TLR4 at the level of hypothalamus may reduce some negative effects of centrally acting endotoxin on the GnRH secretion are generally consistent with the results of our previous study on anestrous ewes with endotoxin-induced inflammation. In that study it was found that blocking of TLR4 components in the hypothalamus, as well as central administration of anti-LPS antibody to the third ventricle of the brain, reduced some suppressive effect of inflammation on the secretion of GnRH/LH [35]. Thus, it can be concluded that blocking TLR4 at the hypothalamic level led to unblocking the inhibition of GnRH secretion, which may confirm the direct action of endotoxin in the hypothalamus in the inhibition of reproductive axis in anestrous ewes. There is no data concerning the influence of peripherally administered TLR4 antagonists on the disturbed by immune challenge GnRH/LH secretion at the central level. However, the study on rats proved that the peripheral administration of TLR4 selective inhibitor TAK-242 prevents the neuroinflammation [50].

In the present study it was also determined that centrally administered LPS decreased GnRH-R gene expression in the ME and AP. Additionally, the blockade of TLR4 reduced the LPS-dependent decrease in the gene expression of GnRH-R in the AP. It seems that reduced GnRH-R gene expression in the ME after icv injection of LPS may result from decreased feedback stimulation of GnRH neurons by GnRH. This phenomenon may be caused by lowered release of this peptide into the portal system by nerve terminals located in the ME [51–53]. Regulation of GnRH-R gene expression in AP is influenced by a multitude of factors including gonadal steroid hormones, inhibin, activin, and perhaps the most importantly, GnRH itself. Normal secretory patterns of GnRH appear to be essential for maintaining a full complement of GnRH-R in the anterior pituitary gland [53]. Decreased GnRH-R gene expression after LPS injection in the AP observed in our experiment may result from reduced GnRH secretion. It can be assumed that lowered GnRH-R gene expression led to lowered GnRH-R expression on the pituitary cells and reduced sensitivity of these cells to GnRH stimulation. Down-regulating GnRH-R gene expression is probably one of the mechanisms by which LPS influences LH secretion at the AP level. Our results are consisted with the previous studies carried out on anestrous ewes where systemically injected endotoxin lowered GnRH-R gene expression in the pituitary gland [54].

Parallel to the reduced GnRH secretion a decreased LH release after icv LPS administration which was reduced by TLR4 antagonist was observed. A lower GnRH secretion could lead to decreasing the GnRH-R expression and as a consequence to the reduction of LH secretion. The dose-dependent inhibitory effect of ventricularly administered LPS on LH secretion have been successfully shown in the experiment on rats, where two doses of endotoxin (5 and 25 μg) induced a significant decrease in plasma LH level [55]. It was also found that administration of anti-IL-1α rabbit serum and recombinant human IL-1 receptor antagonist significantly attenuated the LPS-induced reduction of plasma LH levels but only in the early period after the administration, with no influence on the late period. These results may indicate that IL-1 could participate in the reduction of plasma LH levels induced by icv- injected LPS, especially during the first 60 min, and that the later effect of LPS depends on factors other than IL-1 [55].

In the current study TLR4 gene expression was determined in selected hypothalamic structures (POA, AHA, MBH, ME) which suggests that the activity of this region may be influenced by ligands of this receptor. This finding is in line with the results of our previous studies in which expression of TLR4 mRNA in the ovine hypothalamus was found [34, 35]. Moreover, it was demonstrated that peripheral inflammation induced by intravenous administration of endotoxin resulted in increased TLR4 gene expression [34]. In the study conducted on rats where cellular distribution of TLR4 in the hypothalamus was evaluated by double-immunofluorescence staining of hypothalamic sections, it was shown that the most TLR4-positive cells were microglia cells [56]. In the present study it was shown that icv administration of LPS increased TLR4 gene expression in the MBH. The presence of TLR4 in the hypothalamus enable central action of endotoxin and its influence on the neuroendocrine system. However, this action may have an indirect character and involve mediators synthesized as a result of transduction of these receptor signal. Pro-inflammatory cytokines which can mediate the inhibitory effect of icv-administered LPS at the level of the hypothalamus [3] seem to play an important role in this indirect action [13, 18, 19]. Kaisho and Akira [57] have demonstrated that TLR4 signal transduction induced pro-inflammatory cytokine synthesis. Feng et al. [58] have shown that an inflammatory response in the brain induced by LPS leads to the release of IL-1β into the CSF by endothelial cells, and, consequently to the secretion of cytokines such as IL-1β, IL-6 and TNFα. Moreover, in the studies on ewes it was shown that these pro-inflammatory cytokines are synthesized directly in the hypothalamic area involved in the GnRH-ergic activity [27, 28, 59]. Centrally acting mediators are considered to be responsible for anti-reproductive effect of LPS, in particular IL-1β and TNFα, which are involved in suppression of GnRH/LH secretion [3, 60, 61]. Particularly, IL-1β plays a crucial role in inhibiting the HPG axis activity at hypothalamic level, as it was confirmed in rats [29] and sheep [30].

However, disturbances found in the GnRH secretion after central LPS treatment at least partially may result from the activation of the HPA axis activity. The study demonstrated that icv administration of LPS caused a significant increase in blood plasma level of cortisol, commonly regarded as a marker of stress response. The increase in plasma level of this hormone proves the activation of the HPA stress axis, which can suppress the activity of the HPG axis [62–64]. It has been documented that stress causes changes in the activity of the HPG axis, and the nature of these changes depends on the type of stressor, duration of exposure to that stressor and physiological state of the animal [65, 66]. Hormones and peptides released during stress response play an important role in modulating the influence of stress on the reproductive functions of the organism. The effect of these factors can occur at all levels of the HPG axis [67]. It was shown that immune stress stimulated secretion of corticotropin-releasing hormone (CRH) from the hypothalamus, adrenocorticotropic hormone (ACTH) from the pituitary gland as well as cortisol, corticosterone/cortisone from the adrenal cortex [68, 69]. All mentioned factors have a suppressive effect on the HPG axis [63, 64]. Among others, it has been shown that elevated cortisol level in peripheral blood inhibit LH secretion by decreasing the sensitivity of gonadotropic cells to GnRH [62, 70, 71]. Generally, it is known that stress has a regulatory effect on GnRH gene expression in the ovine hypothalamus [66, 72].

Conclusions

The results of present in vivo experiment indicate that blockade of TLR4 reduces the inhibitory effect of centrally acting LPS on the GnRH gene expression and LH release in anestrous ewes. This suggests that TLR4 and its ligand could be involved in the induction of sickness behavior already in the hypothalamus. Some negative effects of bacterial infection on the HPG axis activity at the hypothalamic level may be caused by LPS crossing the BBB. However, the effect of bacterial endotoxin can also be mediated by the activation of pro-inflammatory cytokines, so it is necessary to undertake further research on the mechanism of LPS action in the organism. Identification of the central pathways responsible for the transmission of LPS signal to GnRH neurons and the role of TLR4 in this process is essential to understand the immune stress-induced reproductive disorders in humans and animals. This knowledge will be helpful in developing newer and more effective treatments for such dysfunctions. Manipulation of TLR4 - mediated immune responses could be a potential approach to treat a variety of inflammation diseases at the CNS level.

Abbreviations

ACTB: 

β-actin

AHA: 

Anterior hypothalamus

AP: 

Anterior pituitary gland

BBB: 

Blood-brain barrier

CD: 

Cluster of differentiation

CNS: 

Central nervous system

CP: 

Choroid plexus

CSF: 

Cerebrospinal fluid

DMSO: 

Dimethyl sulfoxide

GAPDH: 

Glyceraldehyde-3-phosphate dehydrogenase

GnRH: 

Gonadotropin-releasing hormone

GnRH-R: 

Receptor for GnRH

HPA: 

Hypothalamic-pituitary-adrenal

HPG: 

Hypothalamic-pituitary-gonadal

Icv: 

Intracerebroventricular

IL: 

Interleukin

LBP: 

LPS-binding protein

LH: 

Luteinizing hormone

LH-β: 

Beta subunit of luteinizing hormone

LPS: 

Lipopolysacccharide

MBH: 

Medial basal hypothalamus

MD-2: 

Myeloid differentiation factor 2

ME: 

Median eminence

POA: 

Preoptic area

PPIC: 

Cyclophilin C

RIA: 

Radioimmunoassay

TLR: 

Toll-like receptor

TNF: 

Tumor necrosis factor

Declarations

Funding

This research was supported by the National Science Centre, Poland, Grant No. 2013/09/N/NZ9/00212.

Availability of data and materials

All data supporting our findings are included in the manuscript.

Authors’ contributions

KH, APH and DT-Z conceived and designed the experiment; KH, APH, KP, BP, KW and DT-Z performed animal experiment; KH, KP, BP and JB performed laboratory analysis; APH and DT-Z analyzed data; KH, APH, and DT-Z prepared the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All procedures were performed with the consent of the Local Ethics Committee of Warsaw University of Life Sciences (SGGW). Resolution No. 22/2013 of 22 May 2013.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of Sciences, 05-110 Jabłonna, Poland

References

  1. Battaglia DF, Bowen JM, Krasa HB, Thrun LA, Viguié C, Karsch FJ. Endotoxin inhibits the reproductive neuroendocrine axis while stimulating adrenal steroids: a simultaneous view from hypophyseal portal and peripheral blood. Endocrinol. 1997;138:4273–81.View ArticleGoogle Scholar
  2. Iwasa T, Matsuzaki T, Murakami M, Kinouchi R, Gereltsetseg G, Nakazawa H, et al. Effects of lipopolysaccharide exposure at different postnatal time points on the response of LH to homotypic stress in adulthood. J Reprod Immunol. 2012;94:155–60.View ArticlePubMedGoogle Scholar
  3. Tomaszewska-Zaremba D, Herman AP, Haziak K. How does bacterial endotoxin influence gonadoliberin /gonadotropins secretion and action? J Anim Feed Sci. 2016;25:283–91.View ArticleGoogle Scholar
  4. Rietschel ET, Kirikae T, Schade FU, Mamat U, Schmidt G, Loppnow H, et al. Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J. 1994;8:217–25.View ArticlePubMedGoogle Scholar
  5. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C. Du X, Birdwell D, et al. defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in TLR4 gene. Science. 1998;282:2085–8.View ArticlePubMedGoogle Scholar
  6. Kirschning CJ, Bauer S. Toll-like receptors: cellular signal transducers for exogenous molecular patterns causing immune responses. Int J Med Microbiol. 2001;291:251–60.View ArticlePubMedGoogle Scholar
  7. Gioannini TL, Weiss JP. Regulation of interactions of gram-negative bacterial endotoxins with mammalian cells. Immunol Res. 2007;39:249–60.View ArticlePubMedGoogle Scholar
  8. Miyake K. Innate immune sensing of pathogens and danger signals by cell surface toll-like receptors. Semin Immunol. 2007;19:3–10.View ArticlePubMedGoogle Scholar
  9. Fitzgerald KA, Rowe DC, Golenbock DT. Endotoxin recognition and signal transduction by the TLR4/MD2-complex. Microb Infec. 2004;6:1361–7.View ArticleGoogle Scholar
  10. Mitsuzawa H, Nishitani C, Hyakushima N, Shimizu T, Sano H, Matsushima N, et al. Recombinant soluble forms of extracellular TLR4 domain and MD-2 inhibit lipopolysaccharide binding on cell surface and dampen lipopolysaccharide-induced pulmonary inflammation in mice. J Immunol. 2006;177:8133–9.View ArticlePubMedGoogle Scholar
  11. Zhang G, Ghosh S. Negative regulation of toll-like receptor-mediated signaling by Tollip. J Biol Chem. 2002;277:7059–65.View ArticlePubMedGoogle Scholar
  12. Leon CG, Tory R, Jia J, Sivak O, Wasan KM. Discovery and development of toll-like receptor 4 (TLR4) antagonists: a new paradigm for treating sepsis and other diseases. Pharm Res. 2008;25:1751–61.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Haddad JJ, Saade NE, Safieh-Garabedian B. Cytokines and neuro–immune–endocrine interactions: a role for the hypothalamic–pituitary–adrenal revolving axis. J Neuroimmunol. 2002;133:1–19.View ArticlePubMedGoogle Scholar
  14. Battaglia DF, Krasa HB, Padmanabhan V, Viguié C, Karsch FJ. Endocrine alterations that underlie endotoxin induced disruption of the follicular phase in ewes. Biol Reprod. 2000;62:45–53.View ArticlePubMedGoogle Scholar
  15. Williams CY, Harris TG, Battaglia DF, Viguié C, Karsch FJ. Endotoxin inhibits pituitary responsiveness to gonadotropin-releasing hormone. Endocrinology. 2001;142:1915–22.View ArticlePubMedGoogle Scholar
  16. Fergani C, Saifullizam AK, Routly JE, Smith RF, Dobson H. Estrous behavior, luteinizing hormone and estradiol profiles of intact ewes treated with insulin or endotoxin. Physiol Behav. 2012;105:757–65.View ArticlePubMedGoogle Scholar
  17. Harris TG, Battaglia DF, Brown ME, Brown MB, Carlson NE, Viguie’ C, et al. Prostaglandins mediate the endotoxin-induced suppression of pulsatile gonadotropin-releasing hormone and luteinizing hormone secretion in the ewe. Endocrinology. 2000;141:1050–8.View ArticlePubMedGoogle Scholar
  18. Tomaszewska-Zaremba D, Herman AP. The role of immunological system in the regulation of gonadoliberin and gonadotropin secretion. Reprod Biol. 2009;9:11–23.View ArticlePubMedGoogle Scholar
  19. Singh AK, Jiang Y. How does peripheral lipopolysaccharide induce gene expression in the brain of rats? Toxicology. 2004;201:197–207.View ArticlePubMedGoogle Scholar
  20. Givalois L, Dornand J, Mekaouche M, Solier MD, Bristow AF, Ixart G, et al. Temporal cascade of plasma level surges in ACTH, corticosterone, and cytokines in endotoxin-challenged rats. Am J Phys. 1994;267:R164–70.Google Scholar
  21. Waage A, Halstensen A, Shalaby R, Brandtzaeg P, Kierulf P, Espevik T. Local production of tumor necrosis factor α, interleukin 1, and interleukin 6 in meningococcal meningitis. Relation to the inflammatory response. J Exp Med. 1989;170:1859–67.View ArticlePubMedGoogle Scholar
  22. Fassbender K, Ries S, Schminke U, Schneider S, Hennerici M. Inflammatory cytokines in CSF in bacterial meningitis: association with altered blood flow velocities in basal cerebral arteries. J Neurol Neurosurg Psychiatry. 1996;61:57–61.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Banks WA, Lynch JL, Price TO. Cytokines and the blood-brain barrier. In: Siegel A, Zalcman SS, editors. The neuroimmunological basis of behavior and mental disorders. 1st ed. USA: Springer US; 2009. p. 3–17.View ArticleGoogle Scholar
  24. Skipor J, Szczepkowska A, Kowalewska M, Herman AP, Lisiewski P. Profile of toll-like receptor mRNA expression in the choroid plexus in adult ewes. Acta Vet Hung. 2015;63:69–78.View ArticlePubMedGoogle Scholar
  25. Dantzer R. Cytokine, sickness behavior, and depression. Neurol Clin. 2006;24:441–60.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Kakizaki Y, Watanobe H, Kohsaka A, Suda T. Temporal profiles of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in the plasma and hypothalamic paraventricular nucleus after intravenous or intraperitoneal administration of lipopolysaccharide in the rat: estimation by push-pull perfusion. Endocr J. 1999;46:487–96.View ArticlePubMedGoogle Scholar
  27. Herman AP, Misztal T, Herman A, Tomaszewska-Zaremba D. Expression of interleukin (IL)-1β and IL-1 receptors genes in the hypothalamus of anoestrous ewes after lipopolysaccharide treatment. Reprod Domest Anim. 2010;45:e426–33.View ArticlePubMedGoogle Scholar
  28. Herman AP, Krawczyńska A, Bochenek J, Antushevich H, Herman A, Tomaszewska-Zaremba D. Peripheral injection of SB203580 inhibits the inflammatory-dependent synthesis of proinflammatory cytokines in the hypothalamus. Biomed Res Int. 2014;2014:475152.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Kang SS, Kim SR, Leonhardt S, Jarry H, Wuttke W, Kim K. Effect of interleukin-1β on gonadotropin-releasing hormone (GnRH) and GnRH receptor gene expression in castrated male rats. J Neuroendocrinol. 2000;12:421–9.View ArticlePubMedGoogle Scholar
  30. Herman AP, Misztal T, Romanowicz K, Tomaszewska-Zaremba D. Central injection of exogenous IL-1β in the control activities of hypothalamic pituitary gonadal axis in anestrous ewes. Reprod Domest Anim. 2012;47:44–52.View ArticlePubMedGoogle Scholar
  31. Herman AP, Krawczyńska A, Bochenek J, Haziak K, Romanowicz K, Misztal T, et al. The effect of rivastigmine on the LPS-induced suppression of GnRH/LH secretion during the follicular phase of the estrous cycle in ewes. Anim Reprod Sci. 2013;138:203–12.View ArticlePubMedGoogle Scholar
  32. Herman AP, Skipor J, Krawczyńska A, Bochenek J, Wojtulewicz K, Antushevich H, et al. Peripheral inhibitor of AChE, neostigmine, prevents the inflammatory dependent suppression of GnRH/LH secretion during the follicular phase of the estrous cycle. Biomed Res Int. 2017;2017:6823209.PubMedPubMed CentralGoogle Scholar
  33. Chakravarty S, Herkenham M. Toll-like receptor 4 on nonhematopoietic cells sustains CNS inflammation during endotoxemia, independent of systemic cytokines. J Neurosci. 2005;25:1788–96.View ArticlePubMedGoogle Scholar
  34. Herman AP, Herman A, Haziak K, Tomaszewska-Zaremba D. Immune stress up regulates TLR4 and Tollip gene expression in the hypothalamus of ewes. J Anim Feed Sci. 2013;22:13–8.View ArticleGoogle Scholar
  35. Haziak K, Herman AP, Tomaszewska-Zaremba D. Effects of central injection of anti-LPS antibody and blockade of TLR4 on GnRH/LH secretion during immunological stress in anestrous ewes. Mediat Inflamm. 2014;2014:867170.View ArticleGoogle Scholar
  36. Bochenek J, Skipor J, Kowalewska M, Herman AP. The toll-like receptors mRNA expression profile in the pineal gland of sheep during long and short days. J Anim Feed Sci. 2015;24:208–15.View ArticleGoogle Scholar
  37. Jack CS, Arbour N, Manusow J, Montgrain V, Blain M, McCrea E, et al. TLR signaling tailors innate immune responses in human microglia and astrocytes. J Immunol. 2005;175:4320–30.View ArticlePubMedGoogle Scholar
  38. Haziak K, Herman AP, Tomaszewska-Zaremba D. The effect of LPS on LH release and gene expression of LH-β, GnRH-R and TLR4 in the anterior pituitary of follicular phase ewes – an in vitro study. J Anim Feed Sci. 2013;22:97–105.View ArticleGoogle Scholar
  39. Chen G, McCuskey RS, Reichlin S. Blood interleukin-6 and tumor necrosis factor-alpha elevation after intracerebroventricular injection of Escherichia coli endotoxin in the rat is determined by two opposing factors: peripheral induction by LPS transferred from brain to blood and inhibition of peripheral response by a brain-mediated mechanism. Neuroimmunomodulation. 2000;8:59–69.View ArticlePubMedGoogle Scholar
  40. Banks WA, Robinson SM. Minimal penetration of lipopolysaccharide across the murine blood-brain barrier. Brain Behav Immun. 2010;24:102–9.View ArticlePubMedGoogle Scholar
  41. Vargas-Caraveo A, Sayd A, Maus SR, Caso AR, Madrigal LM, Bueno BG, Leza JC. Lipopolysaccharide enters the rat brain by lipoprotein-mediated transport mechanism in physiological conditions. Sci Rep. 2017;7:13113.View ArticlePubMedPubMed CentralGoogle Scholar
  42. Traczyk W, Przekop F. Methods of investigation of the function of the hypothalamus and hypophysis in chronic experiments in sheep. Acta Phys Pol A. 1963;14:217–26.Google Scholar
  43. Stupnicki R, Madej A. Radioimmunoassay of LH in blood plasma of farm animals. Endokrinologie. 1976;68:6–13.PubMedGoogle Scholar
  44. Kokot F, Stupnicki R, editors. Metody radioimmunologiczne i radiokompetycyjne stosowane w klinice. 2nd ed. Warsaw: PZWL; 1985.Google Scholar
  45. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-excel-based tool using pair-wise correlations. Biotechnol Lett. 2004;26:509–15.View ArticlePubMedGoogle Scholar
  46. Bradford MM. Rapid and sensitive method for the quantitation of the microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.View ArticlePubMedGoogle Scholar
  47. Caldani M, Batailler M, Thiéry JC, Dubois MP. LHRH - immunoreactive structure in the sheep brain. Histochemistry. 1988;89:129–39.View ArticlePubMedGoogle Scholar
  48. Schally AV, Arimura A, Kastin AJ, Matsuo H, Baba Y, Redding TW, et al. Gonadotropin-releasing hormone: one polypeptide regulates secretion of luteinizing and follicle-stimulating hormones. Science. 1971;173:1036–8.View ArticlePubMedGoogle Scholar
  49. Sotowska-Brochocka J. Regulacja cyklu owulacyjnego u samic ssaków. In: Sotowska-Brochocka J, editor. Fizjologia Zwierząt. Zagadnienia Wybrane. 1st ed. Warsaw: Wydawnictwa Uniwersytetu Warszawskiego; 2001. p. 228–81.Google Scholar
  50. Gárate I, García-Bueno B, Muñoz Madrigal JL, Caso JR, Alou L, Gómez-Lus ML, et al. Toll-like 4 receptor inhibitor TAK-242 decreases neuroinflammation in rat brain frontal cortex after stress. J Neuroinfl. 2014;11:8.View ArticleGoogle Scholar
  51. Marchetti B, Reeves JJ, Pelletier G, Labrie F. Modulation of pituitary luteinizing hormone releasing hormone receptors by sex steroids and luteinizing hormone releasing hormone in the rat. Biol Reprod. 1982;27:133–45.View ArticlePubMedGoogle Scholar
  52. Stojilkovic SS, Catt KJ. Expression and signal transduction pathways of gonadotropin-releasing hormone receptors. Recent Prog Horm Res. 1995;50:161–205.PubMedGoogle Scholar
  53. Rispoli LA, Nett TM. Pituitary gonadotropin-releasing hormone (GnRH) receptor: structure, distribution and regulation of expression. Anim Reprod Sci. 2005;88:57–74.View ArticlePubMedGoogle Scholar
  54. Herman AP, Tomaszewska-Zaremba D. Effect of endotoxin on the expression of GnRH and GnRHR genes in the hypothalamus and anterior pituitary gland of anestrous ewes. Anim Reprod Sci. 2010;120:105–11.View ArticlePubMedGoogle Scholar
  55. Ebisui O, Fukata J, Tominaga T, Murakami N, Kobayashi H, Segawa H, et al. Roles of interleukin-1α and -1β in endotoxin-induced suppression of plasma gonadotropin levels in rats. Endocrinology. 1992;130:3307–13.View ArticlePubMedGoogle Scholar
  56. Milanski M, Degasperi G, Coope A, Morari J, Denis R, Cintra DE, et al. Saturated fatty acids produce an inflammatory response predominantly through the activation of TLR4 signaling in hypothalamus: implications for the pathogenesis of obesity. J Neurosci. 2009;29:359–70.View ArticlePubMedGoogle Scholar
  57. Kaisho T, Akira S. Toll-like receptor function and signaling. J Allergy Clin Immunol. 2006;117:979–87.View ArticlePubMedGoogle Scholar
  58. Feng SYS, Yu VYH, Walker AM. Endotoxin-induced circulatory changes in the newborn brain: a review. HK J Paediatr (New Series). 2007;12:111–7.Google Scholar
  59. Herman AP, Krawczyńska A, Bochenek J, Haziak K, Antushevich H, Herman A, Tomaszewska-Zaremba D. Inhibition of acetylcholinesterase activity by rivastigmine decreases lipopolysaccharide-induced IL-1β expression in the hypothalamus of ewes. Domest Anim Endocrinol. 2013;44:109–14.View ArticlePubMedGoogle Scholar
  60. Kalra PS, Edwards TG, Xu B, Jain M, Kalra SP. The anti-gonadotropic effects of cytokines: the role of neuropeptides. Domest Anim Endocrinol. 1998;15:321–32.View ArticlePubMedGoogle Scholar
  61. McCann SM, Kimura M, Karanth S, Yu WH, Mastronardi CA, Rettori V. The mechanism of action of cytokines to control the release of hypothalamic and pituitary hormones in infection. Ann N Y Acad Sci. 2000;917:4–18.View ArticlePubMedGoogle Scholar
  62. Debus N, Breen KM, Barrell GK, Billings HJ, Brown M, Young EA, Karsch FJ. Does cortisol mediate endotoxin-induced inhibition of pulsatile luteinizing hormone and gonadotropin-releasing hormone secretion? Endocrinology. 2002;143:3748–58.View ArticlePubMedGoogle Scholar
  63. Dobson H, Ghuman S, Prabhakar S, Smith RA. Conceptual model of the influence of stress on female reproduction. Reproduction. 2003;125:151–63.View ArticlePubMedGoogle Scholar
  64. Maeda K, Tsukamura H. The impact of stress on reproduction: are glucocorticoids inhibitory or protective to gonadotropin secretion? Endocrinology. 2006;147:1085–6.View ArticlePubMedGoogle Scholar
  65. Tomaszewska D, Mateusiak K, Przekop F. Changes in extracellular LHRH and beta-endorfin-like immunoreactivity in the nucleus infundibularis-median eminence of anestrous ewes under stress condition. J neural. Trans. 1999;106:265–74.Google Scholar
  66. Ciechanowska M, Łapot M, Malewski T, Misztal T, Mateusiak K, Przekop F. Effect of stress on the expression of GnRH and GnRH receptor (GnRH-R) genes in the preoptic area-hypothalamus and GnRH-R gene in the stalk/median eminence and anterior pituitary gland in ewes during follicular phase of the estrous cycle. Acta Neurobiol Exp. 2007;67:1–12.Google Scholar
  67. Rivier C, Rivest S. Effect of stress on the activity of the hypothalamic-pituitary-gonadal axis: peripheral and central mechanisms. Biol Reprod. 1991;45:523–32.View ArticlePubMedGoogle Scholar
  68. Dadoun F, Guillaume V, Sauze N, Farisse J, Velut JG, Orsoni JC, et al. Effect of endotoxin on the hypothalamic-pituitary-adrenal axis in sheep. Eur J Endocrinol. 1998;138:193–7.View ArticlePubMedGoogle Scholar
  69. Melmed S. Series introduction. The immuno-neuroendocrine interface. J Clin Invest. 2001;108:1563–6.View ArticlePubMedPubMed CentralGoogle Scholar
  70. Breen KM, Karsch FJ. Does cortisol inhibit pulsatile luteinizing hormone secretion at the hypothalamic or pituitary level? Endocrinology. 2004;145:692–8.View ArticlePubMedGoogle Scholar
  71. Wagenmaker ER, Breen KM, Oakley AE, Tilbrook AJ, Karsch FJ. Psychosocial stress inhibits amplitude of gonadotropin-releasing hormone pulses independent of cortisol action on the type II glucocorticoid receptor. Endocrinology. 2009;150:762–9.View ArticlePubMedGoogle Scholar
  72. Łapot M, Ciechanowska M, Malewski T, Misztal T, Mateusiak K, Przekop F. The effect of stress on the expression of GnRH and GnRH receptor genes in the discrete regions of the hypothalamus and pituitary of anestrous ewes. Reprod Biol. 2007;7:55–71.PubMedGoogle Scholar
  73. Herman AP, Krawczyńska A, Bochenek J, Antushevich H, Herman A, Tomaszewska-Zaremba D. Involvement of prolactin in the meloxicam-dependent inflammatory response of the gonadotropic axis to prolonged lipopolysaccharide treatment in anoestrous ewes. Reprod Fertil Dev. 2016;28:914–23.View ArticlePubMedGoogle Scholar
  74. Chang JS, Russell GC, Jann O, Glass EJ, Werling D, Haig DM. Molecular cloning and characterization of toll-like receptors 1-10 in sheep. Vet Immunol Immunopathol. 2009;127:94–105.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement

Journal of Animal Science and Biotechnology

ISSN: 2049-1891