Skip to main content

Advertisement

Table 1 Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interests

From: Effect of CD14/TLR4 antagonist on GnRH/LH secretion in ewe during central inflammation induced by intracerebroventricular administration of LPS

Gene GenBank Acc. No. Amplicon Size, bp Sequence (5′ → 3′)
Forward Reverse
GAPDH a NM_001034034 134 AGAAGGCTGGGGCTCACT GGCATTGCTGACAATCTTGA
ACTB b U39357 168 CTTCCTTCCTGGGCATGG GGGCAGTGATCTCTTTCTGC
PPIC c NM_001076910 131 ACGGCCAAGGTCTTCTTTG TATCCTTTCTCTCCCGTTGC
GnRH d U02517 123 GCCCTGGAGGAAAGAGAAAT GAGGAGAATGGGACTGGTGA
GnRH-R e NM_001009397 150 TCTTTGCTGGACCACAGTTAT GGCAGCTGAAGGTGAAAAAG
TLR4 fg AY957615 117 GGTTCCCAGAACTGCAAGTG GGATAGGGTTTCCCGTCAGT
IL-1β h X54796.1 137 CAGCCGTGCAGTCAGTAAAA GAAGCTCATGCAGAACACCA
  1. References: a[28]; b[28]; c[28]; d[73]; e[73]; f[34]; g[74]; h[28]