- Research
- Open access
- Published:
Proline metabolism is essential for alkaline adaptation of Nile tilapia (Oreochromis niloticus)
Journal of Animal Science and Biotechnology volume 15, Article number: 142 (2024)
Abstract
Background
Saline-alkaline water aquaculture has become a key way to mitigate the reduction of freshwater aquaculture space and meet the increasing global demand for aquatic products. To enhance the comprehensive utilization capability of saline-alkaline water, it is necessary to understand the regulatory mechanisms of aquatic animals coping with saline-alkaline water. In this study, our objective was to elucidate the function of proline metabolism in the alkaline adaptation of Nile tilapia (Oreochromis niloticus).
Results
Expose Nile tilapia to alkaline water of different alkalinity for 2 weeks to observe changes in its growth performance and proline metabolism. Meanwhile, to further clarify the role of proline metabolism, RNA interference experiments were conducted to disrupt the normal operation of proline metabolic axis by knocking down pycr (pyrroline-5-carboxylate reductases), the final rate-limiting enzyme in proline synthesis. The results showed that both the synthesis and degradation of proline were enhanced under carbonate alkalinity stress, and the environmental alkalinity impaired the growth performance of tilapia, and the higher the alkalinity, the greater the impairment. Moreover, environmental alkalinity caused oxidative stress in tilapia, enhanced ion transport, ammonia metabolism, and altered the intensity and form of energy metabolism in tilapia. When the expression level of the pycr gene decreased, the proline metabolism could not operate normally, and the ion transport, antioxidant defense system, and energy metabolism were severely damaged, ultimately leading to liver damage and a decreased survival rate of tilapia under alkalinity stress.
Conclusions
The results indicated that proline metabolism plays an important role in the alkaline adaptation of Nile tilapia and is a key regulatory process in various biochemical and physiological processes.
Introduction
In recent years, global climate change and human activities have resulted in a worldwide decline in fresh water resources, directly reducing the available space for freshwater aquaculture and limiting its development. Therefore, exploring alternative aquaculture water types is beneficial for promoting global aquaculture development [1,2,3]. Saline-alkaline water is distributed in over 100 countries, and although it characterized by high salinity, alkalinity, and pH levels, it still has great potential and application value [4, 5]. Previous reports indicated that certain economically species can be raised in inland alkaline brackish water, such as pacific white shrimp (Litopenaeus vannamei), Lake Qinghai scaleless carp (Gymnocypris przewalskii), blue mussel (Mytilus edulis), razor clam (Sinonovacula constricta), and Nile tilapia (Oreochromis niloticus) [6,7,8,9,10]. Although these species can survive in certain saline-alkaline conditions, their growth performance, alkalinity tolerance, and other aspects are still affected. Therefore, understanding the saline-alkaline tolerance regulation mechanisms of saline-alkaline tolerant species remains an important issue for promoting the development of saline-alkaline water aquaculture.
High carbonate alkalinity is considered to be one of the main risk factor for aquatic animals in saline-alkaline water [11]. Studies have shown that as the salinity and alkalinity of water increase, the toxic effects of CO32− and HCO3− on aquatic animals also increase. This negatively affects the growth and development, tissue structure, respiratory system, nutritional metabolism, antioxidant defense system, immune regulation, and intestinal health of aquatic animals, leading to various abnormal physiological and biochemical manifestations and even mortality [12, 13]. Further studies have shown that amino acid metabolism and lipid metabolism were affected by saline-alkaline environment, including glutamine metabolism, which has been reported in fish [2, 14, 15]. However, the process and regulatory mechanisms of adaptation of aquatic animals to saline-alkaline environments remain incompletely understood.
It has been proved that the accumulation of proline occurred under stress condition in various organisms [16, 17]. As a proteinogenic amino acid with special conformational rigidity, proline has multiple functions, playing various roles in osmoprotection, antioxidant reactions, protein synthesis, cell signal transduction, apoptosis, and cell survival [18, 19]. The accumulation of proline is regulated by the balance between biosynthesis and degradation, forming a cycle with glutamate and ornithine as the main sources of proline biosynthesis and its final product of catabolism [18]. The entire process involves multiple metabolic enzymes, among which pyrroline-5-carboxylate reductases (PYCRs) are the final enzyme in proline synthesis, and proline dehydrogenase (PRODH) is the first enzyme in proline degradation [20]. Proline metabolism plays a crucial role in regulating intracellular redox homeostasis, participating in energy storage and transfer, energy reduction, and coupling with the mitochondrial respiration through the tricarboxylic acid cycle (TCA) and the electron transport chain (ETC), thereby affecting cell survival and death [21, 22]. Therefore, compared with the characteristics of the amino acid itself, the dynamic changes of proline metabolism may be more conducive to enhance the tolerance of organisms under environmental stress [23]. Under alkaline conditions, organisms undergo a series of changes in amino acid metabolism and content to maintain homeostasis [24,25,26,27]. However, whether proline metabolism plays an important role in the alkaline adaptation in fish is largely unknown.
Nile tilapia (Oreochromis niloticus)Â is an economically important euryhaline fish with high nutritional value and resistance to disease and stress, and can also adapt to a certain level of alkalinity stress [28,29,30]. Therefore, it is appropriate to use tilapia as the research subject to explore the response and mechanism of aquatic animals to alkalinity stress. In this study, acute alkalinity stress and RNA interference trials were used to determine the importance of proline metabolism in the alkalinity tolerance. The results will provide important clues for understanding the regulatory strategies of tilapia under alkalinity stress, and can serve as theoretical basis for the optimization of saline-alkaline water aquaculture.
Materials and methods
Design and synthesis of dsRNA
Various cDNA sequences of the Nile tilapia pycr gene obtained from NCBI were aligned to determine its conserved sequence. Specific primers for the double-stranded RNA (pycr-dsRNA) were subsequently designed (Table 1). Subsequently, pycr-dsRNA was prepared, in short, the target segment was amplified using Nile tilapia liver cDNA as a template according to the instructions (R045B, Takara, Dalian, China), purified, and then ligated with vectors. The resulting plasmids were introduced into recipient cells for cultivation, and bacterial cultures with correct target sequences were selected for sequencing. Plasmids were extracted from correctly sequenced bacteria (9760, Takara, Dalian, China). Following the instructions (R045B, Takara, Dalian, China), target segments containing the T7 promoter (5′TAATACGACTCACTATAGGG3′) were amplified using correctly sequenced plasmids as templates, followed by extracted and in vitro transcription (6140, Takara, Dalian, China). Finally, the concentration and purity were verified via gel electrophoresis (1.2% denaturing agarose) and a Nanodrop 2000, and diethyl pyrocarbonate water was added to adjust the concentration to 5,000 ng/g, and stored at −20 °C for later use.
Experimental animals and experimental design
The fish used in this study were procured from Guangdong Tianfa Fish Fry Development Co. Ltd. (China). Before the test, tilapia underwent a 2-week acclimation period within a 500-L tank at the Biological Experimental Station of East China Normal University. During the acclimation period, the fish were fed commercial feed (China Tongwei Group Co., Ltd.) twice daily (at 8:00 and 17:00) until satiety was evident. After 2 weeks of acclimatization, 360 juvenile Nile tilapia (3.61 ± 0.02 g) with similar physical fitness were selected and randomly allocated to twelve 200-L aquaculture tanks with 30 fish in each tank. The 12 fish tanks were randomly divided into 4 groups (FW group, fish cultured in fresh water; AW-2 group, fish cultured in alkaline water with an alkalinity of 23.81 mmol/L; AW-3 group, fish cultured in alkaline water with an alkalinity of 35.71 mmol/L; AW-4 group, fish cultured in alkaline water with an alkalinity of 47.61 mmol/L) for the experiment, with 3 replicates per group. The remaining fish continued to be temporarily cultured. During the stress period, commercial diet was fed with apparent satiety twice a day. At the end of the 2-week stress experiment, the tilapia in each tank were counted to assess the survival rate (SR).
After the acute stress experiment, a total of 180 Nile tilapia, which were healthy and no body surface damage with similar body weight, were selected from the remaining temporary fish and randomly divided into 6 groups (FWb group, fish cultured in fresh water without injection; FWc group, fish cultured in fresh water and injected with sterile saline; FWp group, fish cultured in fresh water and injected with 5,000Â ng/g sterile pycr-dsRNA; AW group, fish cultured in alkaline water with an alkalinity of 59.52Â mmol/L without injection; AWc group, fish cultured in alkaline water with an alkalinity of 59.52Â mmol/L and injected with sterile saline; AWp group, fish cultured in alkaline water with an alkalinity of 59.52Â mmol/L and injected with 5,000Â ng/g sterile pycr-dsRNA). There were 3 replicates per group and 10 fish per replicate. The injection site was below the left pectoral fin on the abdominal cavity of each fish. 24Â h after injection, fish were exposed to fresh water or 59.52Â mmol/L carbonate alkaline water for 48Â h, during which death was observed and recorded.
After the survival rate experiment, the above procedure was repeated, and 180 fish were randomly selected from the remaining temporary fish and injected, but 24 h after injection, fish were exposed to fresh water or 59.52 mmol/L carbonate alkaline water for 3 h before sampling. During all trial, the controlled environmental conditions were a temperature of 26 ± 1 °C, a dissolved oxygen concentration ranging from 5.0 to 6.0 mg/L, 12 h of light and 12 h of darkness. In addition, during domestication and 2 weeks of stress, two-thirds of the water in each tank was replaced daily.
Sample collection
After 2 weeks of acute alkalinity stress, fish were anesthetized with tricaine methanesulfonate (MS-222), then weighed, measured, and counted to determine growth performance. Six fish were randomly selected, and the tail vein blood was rapidly drawn with a 1-mL sterile syringe, then centrifuged at 3,500 r/min for 10 min, and the serum was separated and stored in the refrigerator at −80 °C for subsequent detection. Similarly, six fish were randomly selected, dissected on ice, the liver and visceral masses were weighed, and the liver, gill, and kidney were subsequently collected and immediately stored at −80 °C.
After 3 h of alkalinity stress, 6 fish in each group were randomly selected to be anesthetized on ice, and the blood from tail vein was quickly extracted, then the serum was separated and stored in the refrigerator at −80 °C until tested. The liver, gill and kidney were collected after dissection with sterilized scissors and tweezers and immediately stored at −80 °C. Growth performance parameters were calculated as follows:
Histological analysis
After 3Â h of alkalinity stress, livers of three fish in each group were randomly selected, fixed in 4% paraformaldehyde solution for 48Â h, washed in 70% ethanol solution, and then transferred to 70% ethanol solution for storage until histological analysis. The subsequent processes were carried out according to the methods in previous articles from our laboratory [31].
Analysis of ion regulation and ammonia metabolism related indexes
The contents of Na+ (C002-1-1), K+ (C001-2-1), Cl− (C003-2-1), blood ammonia (A086-1-1) and urea nitrogen (C013-2-1) in serum were determined with commercial kits purchased from Nanjing Jiancheng Bioengineering Institute. The collected gill tissue was homogenized (1:9, w/v) in 0.86% NaCl cold solution, and the homogenate was used to detect the activity of Na+/K+-ATPase (NKA) and the total protein concentration (A047-1-1, A045-4-2).
Determination of proline content
According to the manufacturer’s instructions, the content of proline in different tissues (liver, gill, kidney and serum) was quantified by the commercial kit (BC0295, Solarbio Technology Co., Ltd., Beijing, China). The absorbance at a wavelength of 520 nm was measured, and then the proline content was calculated.
Assay of oxidative stress and antioxidant parameters
The collected liver tissue was homogenized with the appropriate homogenization medium according to the manufacturer's instructions, and the homogenate was separated by centrifugation and stored at −80 °C for later use. The liver homogenate was used to detect the malonaldehyde (MDA, A003-1-2), glutathione (GSH, A061-1-2), glutathione oxidized (GSSG, A061-1-2), triphosphopyridine nucleotide (NADPH, A115-1-1) and nicotinamide adenine dinucleotide phosphate (NADP+, A115-1-1) content; total antioxidant capacity (T-AOC, A015-2-1), superoxide dismutase (SOD, A001-3-2), catalase (CAT, A007-1-1), glutathione reductase (GR, A062-1-1) and glutathione peroxidase (GSH-Px, A005-1-2) activities with the kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The total protein concentration (A045-4-2) in liver tissue sample was also determined according to the corresponding commercial kits.
Prior to measuring reactive oxygen species (ROS), the liver cells were isolated. The fish were anesthetized using MS-222, followed by careful extraction of liver samples using sterile scissors and tweezers. The samples were then rinsed in phosphate buffer saline (PBS) solution. After absorption of the PBS, pancreatic enzymes (Shanghai XP Biomed Ltd., China) were added to the liver sample, which was subsequently cut into small pieces (approximately 1 mm3) using sterile scissors. These pieces were transferred to a 15-mL sterile centrifuge tube and immersed in water at 28 °C for 20 min. An equal volume of L15 medium (Cytiva Bio-technology Co., Ltd., Hangzhou, China) was added and centrifuged at 1,000 r/min for 5 min. Following removal of the supernatant, a wash with red cell lysate (Tiangen Biotech Co., Ltd., Beijing, China) was performed. The content of ROS (S0033S) in liver was detected with the kit (Beyotime Biotech Inc., Shanghai, China) according to the instructions.
Glycometabolism related index analysis
Part of the liver samples were weighed and the contents of liver glycogen (A043-1-1) and lactic acid (A019-2-1) were detected with the kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the instructions, and the contents of glycogen (A043-1-1) and lactic acid (A019-2-1) in the serum were quantified. The content of adenosine triphosphate (ATP, S0026) in the liver was detected using the corresponding commercial kits (Beyotime Biotech Inc., Shanghai, China), and glucose-6-phosphate dehydrogenase (G6PDH) activity in liver was determined by the commercial kit (BC0265, Solarbio Technology Co., Ltd., Beijing, China).
Quantitative real-time PCR
Total mRNA from the liver, gill and kidney was extracted using TRIzol reagent (Takara, Dalian, China). The quality and concentration of total RNA were measured by the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). Then using the reverse transcription kit (RR047, Takara, Japan) synthesized cDNA and stored at −80 °C. All of the real-time PCR analyses were used an RT‒PCR kit (Vazyme Biotech Co., Ltd., Nanjing, China), and the total reaction volume was 10 μL. The primer sequences of each gene were listed in Table 1, and β-actin was used as reference gene to normalize cDNA loading. The expression of related genes was calculated by the 2−ΔΔCt method.
Data analysis
SPSS Statistics 27 was used for all statistical analyses. All data are expressed as the mean ± standard error of the mean (SEM) and met the normal distribution and variance homogeneity test. One-way ANOVA of variance was used to analyze the data of the groups treated 2 weeks of alkalinity stress. Then, the independent-samples t-test was adopted to analyze data of the groups treated 3 h of alkalinity stress. For all the data, P < 0.05 indicated statistical significance. In addition, Pearson correlation analysis was used to analyze the correlation between feed intake and growth performance parameters (WG, CF and SR). Asterisk (*) represents a significant difference between groups (P < 0.05). Double star (**) represents a significant difference between groups (P < 0.01). Three stars (***) represents a significant difference between groups (P < 0.001). A, B, C and a, b, c on bars without a common superscript letter are significantly different (P < 0.05) (A/a represents the lowest value).
Results
Growth performance and physiological parameters of Nile tilapia after 2Â weeks of alkalinity stress
The growth and physiological parameters of tilapia in each group are shown in Table 2. Fish in the fresh water group had the highest rate of WG and CF, while the HSI is lowest (P < 0.05). There were no significant differences in VSI among the alkalinity treatment groups (P > 0.05). Alkalinity exerted a notable influence on survival rate and feed intake, and the higher the alkalinity, the lower the survival rate and feed intake during the same period (P < 0.05). In addition, feed intake was positively correlated with growth performance (WG, CF and SR, P < 0.05).
Proline content and proline metabolism of Nile tilapia after 2Â weeks of alkalinity stress
The contents of proline in liver, gill, kidney and serum of tilapia were affected by alkalinity, and showed a significant upward trend with the increase of alkalinity (P < 0.05, Fig. 1D–G). At the same time, alkalinity had significant effects on the mRNA expression of genes related to proline decomposition and synthesis in liver, gill and kidney of tilapia (P < 0.05, Fig. 1A–C). In general, the increase of alkalinity in water led to an increase in proline content and a more active proline metabolism of tilapia.
Interference efficiency of pycr-dsRNA
The interference efficiency of pycr-dsRNA is shown in Fig. 2. Compared with the FWc group, the interference efficiency of pycr-dsRNA injection on pycr3, pycr1a and pycr1b in the FWp group was 47%, 40% and 72%, respectively. In addition, there was no significant difference in pycr mRNA expression between FWb group and FWc group, nor between AW group and AWc group. Therefore, in order to exclude the influence of injection operation itself and facilitate the analysis and discussion of the results, only the FWc group, AWc group and AWp group were selected for analysis and comparison.
Effect of pycr-dsRNA on alkalinity tolerance of Nile tilapia
The survival curve of tilapia after 48 h of alkalinity stress (Fig. 3) shows a survival rate of less than 30% for the AWp group, while the rate for the AWc group was over 50%. FWc, AWc and AWp groups had survival rate of 100%, 58.1% and 26.7%, respectively. In general, the decrease of pycr gene mRNA expression significantly reduced the survival rate of tilapia in alkaline water.
Effect of pycr-dsRNA on hepatic oxidative stress related parameters of Nile tilapia
After alkalinity stress, MDA content in liver was significantly increased, as were the activities of T-AOC, SOD and CAT. The MDA content in liver of Nile tilapia was further increased after injection of pycr-dsRNA, while the activity of T-AOC was significantly decreased (P < 0.05, Fig. 4A–D). In addition, alkalinity stress caused a decrease in the activity of GSH-Px in liver, and an increase in the activity of GR and the content of GSH. After injection of pycr-dsRNA, the activity of GR and the GSH content were significantly decreased, the GSSG content accumulated, and the body redox balance was destroyed (P < 0.05, Fig. 4E–H and J). Meanwhile, alkalinity stress caused a significant increase in total NADPH and total NADP+ in the liver, and NADPH/NADP+ ratio decreased significantly after the mRNA expression of pycr decreased (P < 0.05, Fig. 4K, M and N).
The liver morphology of fish in the FWc group was normal with no obvious abnormalities, while there were obvious vacuoles in liver cytoplasm in the AWc group, and the number of vacuoles in the hepatocyte cytoplasm significantly increased after pycr-dsRNA injection (P < 0.05, Fig. 4I). Alkalinity stress caused ROS accumulation in the liver, and the ROS content was significantly increased after pycr-dsRNA injection (P < 0.05, Fig. 4L).
Effects of pycr-dsRNA on serum ammonia content, plasma urea nitrogen content and ion regulation of Nile tilapia
The contents of Na+, K+ and Cl− in serum were significantly increased due to alkalinity stress, and the contents of Na+ and Cl− in serum were significantly decreased after pycr-dsRNA injection (P < 0.05, Fig. 5A–C). The mRNA expression of nka, Na+/H+ exchanger (nhe), cystic fibrosis transmembrane conductance (cftr) and Na+-K+-2Cl− cotransporter (nkcc) and NKA activity in the gill were significantly increased under alkalinity stress. After pycr-dsRNA injection, the mRNA expression and enzyme activity of NKA were significantly decreased, while the mRNA expressions of nhe and nkcc were significantly increased (P < 0.05, Fig. 5D and G). In addition, after alkalinity stress, the serum ammonia content was significantly increased, and after injection of pycr-dsRNA, the serum ammonia content was further increased, while the plasma urea nitrogen content was significantly decreased (P < 0.05, Fig. 5E and F).
Effects of pycr-dsRNA on glycometabolism of Nile tilapia
After alkalinity stress, the contents of serum glucose, lactic acid and liver lactic acid and ATP were significantly increased, while the contents of liver glycogen were significantly decreased. After injection of pycr-dsRNA, the contents of serum glucose, liver ATP and liver glycogen were significantly decreased (P < 0.05, Fig. 6A–E). At the same time, the mRNA expressions of hexokinase (hk), pyruvate kinase (pk), pyruvate carboxylase (pc), glucose-6-phosphatase (g6pase) and the activity of G6PDH in liver were significantly increased, while the mRNA expressions of phosphofructokinase (pfk), pc, g6pase and the activity of G6PDH were significantly decreased after injection of pycr-dsRNA (P < 0.05, Fig. 6F and G).
Effects of pycr-dsRNA on proline content and proline metabolism of Nile tilapia
The contents of proline in liver, kidney and serum were significantly increased after alkalinity stress, while the contents of proline in liver, gill, kidney and serum were significantly decreased after pycr-dsRNA injection (P < 0.05, Fig. 7D–G). Meanwhile, the mRNA expressions of genes related to proline decomposition and synthesis in liver, gill and kidney were significantly increased under alkalinity stress, but decreased significantly after pycr-dsRNA injection (P < 0.05, Fig. 7A–C).
Discussion
Alkalinity has always been considered as a non-biological hazard factor for the survival of aquatic animals [32]. Previous studies have shown that alkalinity can cause chronic and acute damage to aquatic organisms, posing a threat to their growth and survival [9, 33,34,35]. The results of this study showed that tilapia in alkaline water exhibit lower WG, CF and SR compared to those in fresh water, and these parameters decreased further with increasing alkalinity. Organisms consumed more energy to maintain physiological homeostasis in alkaline water, which resulted in less energy for growth and lower survival rate under alkalinity stress [36]. This is consistent with previous studies on other fish, such as Songpu mirror carp (Cyprinus carpio Songpua) and Shemaia (Chalcalburnus chalcoides aralensis) [37, 38]. Additionally, this study demonstrates a significant positive correlation between feed intake and growth performance, suggesting that an important factor in the reduction of growth performance of organisms caused by alkalinity stress is reduced feed intake. Therefore, adjusting feeding strategies or using attractants to increase feed intake may enhance the production value and economic benefits of aquaculture fish within the tolerance range of alkalinity stress.
The effect of carbonate alkalinity stress on aquatic organisms involves several aspects, among which the alteration of amino acid metabolism is a main one [33, 39]. Research on crucian carp (Carassius auratus) have showed that under alkalinity stress, various metabolic pathways including glycine, serine and threonine were changed [40]. Similarly, the total plasma free amino acid content of Amur ide (Leuciscus waleckii) increased with the increase of alkalinity and exposure time, among which the highest changes were proline and valine [41]. This study showed that both the synthesis and degradation of proline in tilapia are enhanced under carbonate alkalinity stress. This is similar with the results of studies on some animals under osmotic stress conditions, such as river nerite (Theodoxus fluviatilis), harpacticoid copepod (Tigriopus brevicornis) and blue crab (Callinectes sapidus) [42,43,44,45]. The upregulation of proline synthesis can help utilize the properties of amino acids themselves, such as osmoprotection, radical scavenging, and alleviation of endoplasmic reticulum stress, on the flip side, the upregulation of proline degradation can increase the availability of proline as stress substrate, including for energy supply and signal pathway modulation [46,47,48]. However, when pycr gene was knocked down, both proline synthesis and catabolism were decreased. Meanwhile, the survival rate of tilapia in alkaline water was further decreased. Therefore, proline metabolism has the potential to be a noteworthy response pathway under alkalinity stress.
Alkalinity stress has been reported to disrupt the homeostasis between the oxidative and antioxidant systems of aquatic organisms, inducing the production of ROS and the accumulation of MDA in vivo, while the prolonged presence of ROS can lead to oxidative stress and liver damage, and MDA reflects the degree of oxidative damage [36, 49, 50]. T-AOC is the total antioxidant capacity of the body, including total enzymes and non-enzymes, and its level reflects the antioxidant capacity of the body [51]. In this study, the activity of T-AOC and the contents of ROS and MDA in the liver were significantly increased by alkalinity stress. Meanwhile, alkalinity caused the appearance of liver cytoplasmic vacuoles, indicating liver damage caused by the disrupted balance of ROS production and clearance in the antioxidant system. Under stress, SOD and CAT, which can convert superoxide anion radical to H2O2 and further reduce H2O2 to O2 and H2O, is generally considered as the primary defense line against ROS [52]. In addition to SOD and CAT, GSH-Px can neutralize H2O2 [53]. In this study, the activity of SOD and CAT increased under alkalinity stress, while the activity of GSH-Px was inhibited. Similar findings have been found in gibel carp (Carassius auratus gibelio) and Amur minnow (Phoxinus lagowskii) [54, 55]. GSH, a crucial non-enzymatic antioxidant, can clear ROS and thus be oxidized to GSSG [56]. In addition, GR and GSH-Px ensure the reduced glutathione pool by coupling with NADPH/NADP+ ratio [57, 58]. We found that alkalinity stress resulted in the increase of GSH content and GR activity, along with elevated levels of NADPH, NADP+ and NADPH/NADP+ ratio, indicating the activation of the antioxidant network to maintain redox homeostasis under alkalinity stress. However, the inhibition of pycr caused further vacuolar degeneration, cell enlargement, and nuclear displacement in liver tissues, which further aggravated oxidative damage of fish liver. Furthermore, GSSG content increased significantly, while GSH, GSH/GSSG ratio, NADPH, NADP+ and NADPH/NADP+ ratio decreased significantly. The entire antioxidant defense system of the organism severely damaged. The proline cycle can transfer the reduction potential from cytoplasm to mitochondria and oxidation potential from mitochondria to cytoplasm, which can keep redox homeostasis, including maintaining NADPH/NADP+ ratio and providing electrons for antioxidant enzymes and decomposition reactions [57, 59,60,61]. Failure of GR binding to its cofactor NADPH leads to a failure in GSH regeneration from its oxidised form GSSG during detoxification, ultimately leading to a decrease in glutathione levels, a lower GSH/GSSG ratio [62,63,64]. Similar to our findings, studies on human fibroblasts suggested that silencing of pycr directly leads to mitochondrial fragmentation, rendering cells sensitive to oxidative stress [65]. Research on zebrafish (Danio rerio) also showed a significant decrease in antioxidant capacity and mitochondrial dysfunction after inhibition of proline biosynthesis [66]. Therefore, proline metabolism contributes to maintaining redox homeostasis and stability of the antioxidant system in tilapia under alkalinity stress, thus helping the body cope with stress.
Under the synergistic effect of high pH and high concentrations of CO32− and HCO3− in carbonate alkalinity, alkalinity stress can also cause the ionic toxicity and acid–base imbalance [67]. The ion homeostasis of tilapia under alkalinity stress depends on multiple ion pumps and transporters, including NKA, NHE, CFTR and NKCC [31]. NKA generates an electrochemical gradient by exchanging Na+ and K+, which not only provides a channel initial force for other transport systems within the gill epithelial, but also collaborates with NHE to capture NH3 into NH4+ and facilitates the excretion of branchial ammonia [68, 69]. NKCC transports Na+, K+, and Cl−, maintaining intracellular Cl− concentration and regulating cell volume [70]. In this study, the gene expressions of nka, nkcc and cftr of tilapia exposed to alkaline water were higher than those of tilapia in fresh water, indicating that tilapia under alkalinity stress maintains acid–base balance and osmotic balance by activating the ion transport system. However, the inhibition of pycr can inhibit the gene expression and enzyme activity of nka, and increase the gene expressions of nhe and nkcc. The possible reason is that amino acids are substrates for energy metabolism under stress conditions in fish, and proline is one of the preferred amino acids. When proline synthesis is inhibited, NKA cannot obtain sufficient energy to participate in cellular ion transport, thereby affecting the entire ion efflux system [25]. Additionally, the imbalance of H+ caused by alkalinity stress also disrupts the balance of NH3 and NH4+ mutual conversion, further leading to the accumulation of serum ammonia, which may affect the function and structure of the gill endoplasmic reticulum (ER), a crucial organelle responsible for protein synthesis, processing, transport and calcium storage [71,72,73,74]. The accumulation of proline can stabilize protein folding and/or promote protein refolding, thus avoiding and/or alleviating ER stress [46]. Inhibition of proline synthesis leads to elevated blood ammonia, which may result enhanced ER stress, further impairing the synthesis and maturation of ion transport proteins [75]. Meanwhile, the oxidative imbalance caused by the obstruction of proline metabolism promoted the upregulation of nhe and nkcc expression. In summary, tilapia under alkalinity stress maintain physiological balance by activating the ion transport system and ammonia metabolism. Among these processes, proline metabolism plays a crucial role to help fish adapt to alkalinity stress [69].
In response to environmental stressors, aquatic organisms activate various regulatory processes by adjusting energy metabolism. Among these, carbohydrate is the direct energy source for aquatic organisms to resist environmental stress [76, 77]. Glucose metabolism is an important pathway of carbohydrate metabolism, including glucose utilization (glycolysis) and generation (gluconeogenesis) [78]. Glycolysis is the only way for fish to decomposition glucose, and has been shown to be significantly activated under environmental stress conditions such as hypoxia and chemical pesticides [79, 80]. In our study, tilapia showed elevated levels of serum glucose and lactate, hepatic ATP and lactate, as well as significantly upregulated expression levels of glycolysis-related genes (hk, pk), which confirmed promoting glycolysis was enhanced in fish under alkalinity stress. Gluconeogenesis is another important pathway that converts non-carbohydrates into glucose to produce ATP [81]. We found that the expressions of pc and g6pase were significantly upregulated under alkalinity stress. However, when the function of pycr gene was inhibited, both the glycolysis and gluconeogenesis were suppressed, resulting in significant decreases in hepatic ATP content and serum glucose content. G6PDH is a rate-limiting enzyme in the pentose phosphate pathway (PPP), which can convert the intracellular carbohydrate decomposition process from glycolysis to PPP, and plays an important biological role in nucleotide and fatty acid synthesis and maintenance of intracellular redox homeostasis [82]. In this study, the activity of G6PDH was increased by alkalinity stress, and decreased after the decrease of pycr gene expression. This might be because that the changed proline biogeneration and NADPH/NADP+ balance affected PPP. Our data suggest that the effect of the proline metabolic axis on glycolysis and PPP under alkalinity stress may be due to its maintenance of NAD(P)+ and NAD(P)H [83]. In addition, PRODH-mediated proline degradation helps maintain ATP levels in cells, while PYCRs are able to maintain PRODH activity in the absence of proline [20, 84]. In order to meet the energy requirements of fish during alkaline stress, glycogen is also mobilized. Our results showed a significant decrease in hepatic glycogen content under alkalinity stress, and a further decrease when pycr gene expression is reduced. In summary, tilapia regulates several pathways through proline metabolism to compensate and meet the energy demand under alkalinity stress.
As a euryhaline fish, Nile tilapia has a certain degree of alkalinity tolerance. But alkalinity stress still poses challenge to the health, growth and survival of tilapia. In this study, proline synthesis and degradation were activated in Nile tilapia under alkalinity stress, while knocking down the pycr gene significantly affects the normal operation of the proline metabolic axis. Meanwhile, the defunction of pycr and abnormal proline metabolism affect the ion transport, antioxidant defense system and energy metabolism, which are supposed to play crucial roles in alkalinity stress. These changes then resulted in liver damage and fish death under alkalinity stress. In summary, proline metabolism plays a crucial role in the alkaline adaptation of Nile tilapia. Further studies are warranted to the mechanism of proline metabolic pathway in response to alkalinity stress.
Conclusion
In conclusion, our study suggests that the proline metabolic axis can serve as a scaffold for the integration of multiple regulatory mechanisms and play a crucial role in the alkaline adaptation of Nile tilapia, which can not only promote energy supply, ion transport and pentose phosphate pathway in fish, but also promote the stability of the antioxidant system by maintaining NAD(P)+ and NAD(P)H. Future studies should delve deeper into the regulation of proline metabolism in order to reveal and improve the regulation and signal network of alkalinity stress response.
Availability of data and materials
The datasets produced and/or analyzed during the current study are available from the corresponding author on reasonable request.
Abbreviations
- ARG1:
-
Arginase-1
- ARG2:
-
Arginase-2
- ATP:
-
Adenosine triphosphate
- CAT:
-
Catalase
- CF:
-
Condition factor
- CFTR:
-
Cystic fibrosis transmembrane conductance regulator
- ER:
-
Endoplasmic reticulum
- ETC:
-
Electron transport chain
- FBPASE:
-
Fructose-1,6-bisphosphatase
- GR:
-
Glutathione reductase
- GSH:
-
Glutathione
- GSH-Px:
-
Glutathione peroxidase
- GSSG:
-
Glutathione disulfide
- G6PASE:
-
Glucose-6-phosphatase
- G6PDH:
-
Glucose-6-phosphate dehydrogenase
- HK:
-
Hexokinase
- HSI:
-
Hepatosomatic index
- MDA:
-
Malonaldehyde
- MS-222:
-
Tricaine methanesulfonate
- NADPH:
-
Triphosphopyridine nucleotide
- NADP+ :
-
Nicotinamide adenine dinucleotide phosphate
- NHE:
-
Na+/H+ exchanger
- NKA:
-
Na+/K+-ATPase
- NKCC:
-
Na+-K+-2Cl− cotransporter
- OAT:
-
Ornithine aminotransferase
- PBS:
-
Phosphate buffer saline
- PC:
-
Pyruvate carboxylase
- PFK:
-
Phosphofructokinase
- PK:
-
Pyruvate kinase
- PPP:
-
Pentose phosphate pathway
- PRODH:
-
Proline dehydrogenase
- PYCR:
-
Pyrroline-5-carboxylate reductase
- PYCR1A:
-
Pyrroline-5-carboxylate reductase-1a
- PYCR1B:
-
Pyrroline-5-carboxylate reductase-1b
- PYCR3:
-
Pyrroline-5-carboxylate reductase-3
- P5CS:
-
Δ1-Pyrroline-5-carboxylate synthetase
- P5CDH:
-
Δ1-Pyrroline-5-carboxylate dehydrogenase
- ROS:
-
Reactive oxygen species
- SOD:
-
Superoxide dismutase
- SR:
-
Survival rate
- T-AOC:
-
Total antioxidant capacity
- TCA:
-
Tricarboxylic acid cycle
- VSI:
-
Visceral index
- WG:
-
Weight gain
References
Dawood MAO, Noreldin AE, Sewilam H. Long term salinity disrupts the hepatic function, intestinal health, and gills antioxidative status in Nile tilapia stressed with hypoxia. Ecotox Environ Safe. 2021;220:112412.
Zhao Y, Zhang C, Zhou H, Song L, Wang J, Zhao J. Transcriptome changes for Nile tilapia (Oreochromis niloticus) in response to alkalinity stress. Comp Biochem Phys D. 2020;33:100651.
Ondrasek G, Rengel Z. Environmental salinization processes: detection, implications & solutions. Sci Total environ. 2021;754:142432.
Cheng Y, Zhao J, Ayisi CL, Cao X. Effects of salinity and alkalinity on fatty acids, free amino acids and related substance anabolic metabolism of Nile tilapia. Aquacult Fish. 2022;7(4):389–95.
Maoxiao P, Xiaojun L, Donghong N, Bo Y, Tianyi L, Zhiguo D, et al. Survival, growth and physiology of marine bivalve (Sinonovacula constricta) in long-term low-salt culture. Sci Rep. 2019;9:2819.
Wei F, Liang J, Tian W, Yu L, Feng Z, Hua Q. Transcriptomic and proteomic analyses provide insights into the adaptive responses to the combined impact of salinity and alkalinity in Gymnocypris przewalskii. Bioresour. Bioprocess. 2022;9:104.
Lim YS, Ganesan P, Varman M, Hamad FA, Krishnasamy S. Effects of microbubble aeration on water quality and growth performance of Litopenaeus vannamei in biofloc system. Aquacult Eng. 2021;93:102159.
Dinh HQ, Fotedar R. Early development of the blue mussel Mytilus edulis (Linnaeus, 1758) cultured in potassium-fortified inland saline water. Aquaculture. 2016;452:373–9.
Peng M, Li Z, Liu X, Niu D, Li J. Inland alkaline brackish water aquaculture of juvenile razor clam: survival, growth, physiology and immune responses. Aquacult Rep. 2020;18:100463.
Zhao Y, Wang Y, Song L, Li S, Chen X, Tang S, et al. Effects of chronic alkalinity stress on immune response in Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila. Aquaculture. 2022;561:738599.
Yao Z, Lai Q, Hao Z, Chen L, Lin T, Zhou K, et al. Carbonic anhydrase 2-like and Na+-K+-ATPase α gene expression in medaka (Oryzias latipes) under carbonate alkalinity stress. Fish Physiol Biochem. 2015;41:1491–500.
Kültz D. Physiological mechanisms used by fish to cope with salinity stress. J Exp Biol. 2015;218:1907–14.
Lu Z, Huang W, Wang S, Shan X, Ji C, Wu H. Liver transcriptome analysis reveals the molecular responses to low-salinity in large yellow croaker Larimichthys crocea. Aquaculture. 2020;517:734827.
Su H, Li Y, Ma D, Fan J, Zhong Z, Zhu H. Metabolism responses in the intestine of Oreochromis mossambicus exposed to salinity, alkalinity and salt-alkalinity stress using LC-MS/MS-based metabolomics. Comp Biochem Phys D. 2023;45:101044.
Li X, Zheng S, Wu G. Nutrition and metabolism of glutamate and glutamine in fish. Amino Acids. 2020;52:671–91.
Ueda A, Yamamoto-Yamane Y, Takabe T. Salt stress enhances proline utilization in the apical region of barley roots. Biochem Bioph Res Co. 2007;355:61–6.
Liang X, Dickman MB, Becker DF. Proline biosynthesis is required for endoplasmic reticulum stress tolerance in saccharomyces cerevisiae. J Biol Chem. 2014;289:27794–806.
Szabados L, Savouré A. Proline: a multifunctional amino acid. Trends Plant Sci. 2010;15:89–97.
Liu N, Yang Y, Si X, Jia H, Zhang Y, Jiang D, et al. L-proline activates mammalian target of rapamycin complex 1 and modulates redox environment in porcine trophectoderm cells. Biomolecules. 2021;11:742.
Natarajan SK, Zhu W, Liang X, Zhang L, Demers AJ, Zimmerman MC, et al. Proline dehydrogenase is essential for proline protection against hydrogen peroxide-induced cell death. Free Radical Bio Med. 2012;53:1181–91.
Sharma S, Villamor JG, Verslues PE. Essential role of tissue-specific proline synthesis and catabolism in growth and redox balance at low water potential. Plant Physiol. 2011;157:292–304.
Phang JM. The regulatory functions of proline and pyrroline-5-carboxylic acid. In: Horecker BL, Stadtman ER, editors. Curr Top Cell Regul. 1985;25:91–132.
Ben Rejeb K, Abdelly C, Savouré A. How reactive oxygen species and proline face stress together. Plant Physiol Biochem. 2014;80:278–84.
Sun Y, Han S, Yao M, Liu H, Wang Y. Exploring the metabolic biomarkers and pathway changes in crucian under carbonate alkalinity exposure using high-throughput metabolomics analysis based on UPLC-ESI-QTOF-MS. RSC Adv. 2020;10:1552–71.
Zhang R, Zhao Z, Li M, Luo L, Wang S, Guo K, et al. Metabolomics analysis reveals the response mechanism to carbonate alkalinity toxicity in the gills of Eriocheir sinensis. Comp Biochem Phys C. 2023;263:109487.
Li W, Wang J, Li J, Liu P, Fei F, Liu B, et al. The effect of astaxanthin on the alkalinity stress resistance of Exopalaemon carinicauda. Sci Total Environ. 2024;917:170415.
Sun Y-C, Han S-C, Yao M-Z, Wang Y-M, Geng L-W, Wang P, et al. High-throughput metabolomics method based on liquid chromatography-mass spectrometry: Insights into the underlying mechanisms of salinity–alkalinity exposure-induced metabolites changes in Barbus capito. J Sep Sci. 2021;44:497–512.
Zhao Y, Wang J, Thammaratsuntorn J, Wu JW, Wei JH, Wang Y, et al. Comparative transcriptome analysis of Nile tilapia (Oreochromis niloticus) in response to alkalinity stress. Genet Mol Res. 2015;14:17916–26.
Ng W, Romano N. A review of the nutrition and feeding management of farmed tilapia throughout the culture cycle. Rev Aquacult. 2013;5:220–54.
Morgan DL, Gill HS, Maddern MG, Beatty SJ. Distribution and impacts of introduced freshwater fishes in western australia. N Z J Mar Freshwater Res. 2004;38:511–23.
Zhu J, Chen L, Huang Y, Zhang F, Pan J, Li E, et al. New insights into the influence of myo-inositol on carbohydrate metabolism during osmoregulation in Nile tilapia (Oreochromis niloticus). Anim Nutr. 2022;10:86–98.
Saha N, Kharbuli ZY, Bhattacharjee A, Goswami C, Häussinger D. Effect of alkalinity (pH 10) on ureogenesis in the air-breathing walking catfish Clarias batrachus. Comp Biochem Phys A. 2002;132:353–64.
Fan Z, Wu D, Zhang Y, Li J, Xu Q, Wang L. Carbonate alkalinity and dietary protein levels affected growth performance, intestinal immune responses and intestinal microflora in Songpu mirror carp (Cyprinus carpio Songpu). Aquaculture. 2021;545:737135.
Wu P, Geng L, Jiang H, Tong G, Li C, Xu W. Tolerance of three Cobitidae fish species to high salinity and alkalinity. J Fish Sci China. 2017;24(2):248.
Yuhong Y, Mingshuai L, Liang L, Shihui W, Rui Z, Kun G, et al. Study on toxicity of salinity and alkalinity on Eriocheir sinensis. Dongbei Nongye Daxue Xuebao. 2022;53:36–41.
Tao S, Li X, Wang J, Bai Y, Wang J, Yang Y, et al. Examination of the relationship of carbonate alkalinity stress and ammonia metabolism disorder-mediated apoptosis in the Chinese mitten crab, Eriocheir sinensis: potential involvement of the ROS/MAPK signaling pathway. Aquaculture. 2024;579:740179.
Fan Z, Peng F, Li J, Wu D, Zhang Y, Wang C, et al. Effects of α-ketoglutarate on growth performance, antioxidant capacity and ammonia metabolization against chronic carbonate alkalinity stress in Songpu mirror carp (Cyprinus carpio Songpu). Aquac Res. 2020;51:2029–40.
Jiang QL, Lin YH, Wang XH, Liu B. Effect of NaHCO3 on growth and osmoregulation of Chalcalbumus chalcoides aralensis. J Jilin Agric Uni. 2008;30(1):106–10.
Lan Z. Ammonia excretion related genes expression of common carp under the stress of carbonate alkalinity. Biol Bull. 2013;23:185–93.
Sun Y-C, Wu S, Du N-N, Song Y, Xu W. High-throughput metabolomics enables metabolite biomarkers and metabolic mechanism discovery of fish in response to alkalinity stress. RSC Adv. 2018;8:14983–90.
Chang Y, He Q, Sun Y, Liang L, Sun X. Changes in plasma free amino acid levels in Leuciscus waleckii exposed to different environmental alkalinity levels. J Fish Sci China. 2016;23(1):117–24.
Willett CS, Burton RS. Characterization of the glutamate dehydrogenase gene and its regulation in a euryhaline copepo. Comp Biochem Phys B. 2003;135:639–46.
Wiesenthal AA, Müller C, Harder K, Hildebrandt J-P. Alanine, proline and urea are major organic osmolytes in the snail Theodoxus fluviatilis under hyperosmotic stress. J Exp Biol. 2019;222:jeb193557.
McAllen R. Variation in the free amino acid concentrations of the supralittoral rockpool copepod crustacean Tigriopus brevicornis during osmotic stress. J Mar Biol Assoc UK. 2003;83:921–2.
Burton RS. Proline synthesis during osmotic stress in megalopa stage larvae of the blue crab. Callinectes sapidus Biol Bull. 1992;182:409–15.
Patriarca EJ, Cermola F, D’Aniello C, Fico A, Guardiola O, De Cesare D, et al. The multifaceted roles of proline in cell behavior. Front Cell Dev Biol. 2021;9:728576.
Zarse K, Schmeisser S, Groth M, Priebe S, Beuster G, Kuhlow D, et al. Impaired insulin/IGF1 signaling extends life span by promoting mitochondrial L-proline catabolism to induce a transient ROS signal. Cell Metab. 2012;15:451–65.
Liu W, Phang JM. Proline dehydrogenase (oxidase) in cancer. BioFactors. 2012;38(6):398–406.
Tian L, Tan P, Yang L, Zhu W, Xu D. Effects of salinity on the growth, plasma ion concentrations, osmoregulation, non-specific immunity, and intestinal microbiota of the yellow drum (Nibea albiflora). Aquaculture. 2020;528:735470.
Tsikas D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenge. Anal Biochem. 2017;524:13–30.
Meng Y, Ma R, Ma J, Han D, Xu W, Zhang W, et al. Dietary nucleotides improve the growth performance, antioxidative capacity and intestinal morphology of turbot (Scophthalmus maximus). Aquacult Nutr. 2017;23:585–93.
Pandey S, Parvez S, Sayeed I, Haque R, Binhafeez B, Raisuddin S. Biomarkers of oxidative stress: a comparative study of river Yamuna fish Wallago attu (Bl. & Schn.). Sci Total Environ. 2003;309:105–15.
Bagnyukova TV, Storey KB, Lushchak VI. Adaptive response of antioxidant enzymes to catalase inhibition by aminotriazole in goldfish liver and kidney. Comp Biochem Phys B. 2005;142:335–41.
Lu Y, Zhang Y, Zhang P, Liu J, Wang B, Bu X, et al. Effects of dietary supplementation with Bacillus subtilis on immune, antioxidant, and histopathological parameters of Carassius auratus gibelio juveniles exposed to acute saline-alkaline conditions. Aquacult Int. 2022;30:2295–310.
Zhou H, Yao T, Zhang T, Sun M, Ning Z, Chen Y, et al. Effects of chronic saline-alkaline stress on gill, liver and intestinal histology, biochemical, and immune indexes in Amur minnow (Phoxinus lagowskii). Aquaculture. 2024;579:740153.
Fang Y-Z, Yang S, Wu G. Free radicals, antioxidants, and nutrition. Nutrition. 2002;18:872–9.
Milica V, Yann C, Parks SK, Jacques P. The central role of amino acids in cancer redox homeostasis: vulnerability points of the cancer redox code. Front Oncol. 2017;7:319.
Rabilloud T, Heller M, Gasnier F, Luche S, Rey C, Aebersold R, et al. Proteomics analysis of cellular response to oxidative stress. Evidence for in vivo overoxidation of peroxiredoxins at their active site. J Biol Chem. 2002;277:19396–401.
Hagedorn CH, Phang JM. Catalytic transfer of hydride ions from NADPH to oxygen by the interconversions of proline and Δ1-pyrroline-5-carboxylat. Arch Biochem Biophys. 1986;248:166–74.
Hillar A, Nicholls P. A mechanism for NADPH inhibition of catalase compound II formation. FEBS Lett. 1992;314:179–82.
Chalecka M, Kazberuk A, Palka J, Surazynski A. P5C as an interface of proline interconvertible amino acids and its role in regulation of cell survival and apoptosis. Int J Mol Sci. 2021;22:11763.
Ganea E, Harding JJ. Glutathione-related enzymes and the eye. Curr Eye Res. 2006;31:1–11.
Cao F, Fu M, Wang R, Diaz-Vivancos P, Hossain MA. Exogenous glutathione-mediated abiotic stress tolerance in plants. In: Hossain MA, Mostofa MG, Diaz-Vivancos P, Burritt DJ, Fujita M, Tran L-SP, editors. Glutathione in plant growth, development, and stress tolerance. Cham: Springer; 2017. p. 171–94.
Koh YS, Wong SK, Ismail NH, Zengin G, Duangjai A, Saokaew S, et al. Mitigation of environmental stress-impacts in plants: role of sole and combinatory exogenous application of glutathione. Front Plant Sci. 2021;12:791205.
Kuo ML, Lee MBE, Tang M, den Besten W, Hu S, Sweredoski MJ, et al. PYCR1 and PYCR2 interact and collaborate with RRM2B to protect cells from overt oxidative stress. Sci Rep. 2016;6:18846.
Liang S-T, Audira G, Juniardi S, Chen J-R, Lai Y-H, Du Z-C, et al. Zebrafish carrying pycr1 gene deficiency display aging and multiple behavioral abnormalities. Cells. 2019;8:453.
Zhang Y, Wen H, Liu Y, Qi X, Sun D, Zhang C, et al. Gill histological and transcriptomic analysis provides insights into the response of spotted sea bass (Lateolabrax maculatus) to alkalinity stress. Aquaculture. 2023;563:738945.
Watanabe S, Niida M, Maruyama T, Kaneko T. Na+/H+ exchanger isoform 3 expressed in apical membrane of gill mitochondrion-rich cells in Mozambique tilapia Oreochromis mossambicus. Fish Sci. 2008;74:813–21.
Liu W, Xu C, Li Z, Chen L, Wang X, Li E. Reducing dietary protein content by increasing carbohydrates is more beneficial to the growth, antioxidative capacity, ion transport, and ammonia excretion of Nile Tilapia (Oreochromis niloticus) under long-term alkalinity stress. Aquacult Nutr. 2023;2023:9775823.
Lorin-Nebel C, Boulo V, Bodinier C, Charmantier G. The Na+/K+/2Cl- cotransporter in the sea bass Dicentrarchus labrax during ontogeny: involvement in osmoregulation. J Exp Biol. 2006;209:4908–22.
Han J, Kaufman RJ. The role of ER stress in lipid metabolism and lipotoxicity. J Lipid Res. 2016;57:1329–38.
Li W, Wang Y, Li C, Wang F, Shan H. Responses and correlation among ER stress, Ca2+ homeostasis, and fatty acid metabolism in Penaeus vannamei under ammonia stres. Aquat Toxicol. 2024;267:106837.
Nan Y, Xiao M, Duan Y, Yang Y. Toxicity of ammonia stress on the physiological homeostasis in the gills of Litopenaeus vannamei under seawater and low-salinity conditions. Biology. 2024;13:281.
Wen J, Chen S, Xu W, Zheng G, Zou S. Effects of high NaHCO3 alkalinity on growth, tissue structure, digestive enzyme activity, and gut microflora of grass carp juvenile. Environ Sci Pollut Res. 2023;30:85223–36.
Marcus EA, Tokhtaeva E, Jimenez JL, Wen Y, Naini BV, Heard AN, et al. Helicobacter pylori infection impairs chaperone-assisted maturation of Na+-K+-ATPase in gastric epithelium. Am J Physiol Gastrointest Liver Physiol. 2020;318:G931–45.
Yu Q, Xie J, Huang M, Chen C, Qian D, Qin JG, et al. Growth and health responses to a long-term pH stress in Pacific white shrimp Litopenaeus vannamei. Aquacult Rep. 2020;16:100280.
Tang S, Liu S, Zhang J, Zhou L, Wang X, Zhao Q, et al. Relief of hypersaline stress in Nile tilapia Oreochromis niloticus by dietary supplementation of a host-derived Bacillus subtilis strain. Aquaculture. 2020;528:735542.
Enes P, Panserat S, Kaushik S, Oliva-Teles A. Nutritional regulation of hepatic glucose metabolism in fish. Fish Physiol Biochem. 2009;35:519–39.
Winkaler EU, Santos TRM, Machado-Neto JG, Martinez CBR. Acute lethal and sublethal effects of neem leaf extract on the neotropical freshwater fish Prochilodus lineatus. Comp Biochem Phys C. 2007;145:236–44.
Ma J-L, Qiang J, Tao Y-F, Bao J-W, Zhu H-J, Li L-G, et al. Multi-omics analysis reveals the glycolipid metabolism response mechanism in the liver of genetically improved farmed Tilapia (GIFT, Oreochromis niloticus) under hypoxia stress. BMC Genomics. 2021;22:105.
Zhu J, Shi W, Zhao R, Gu C, Shen H, Li H, et al. Integrated physiological, transcriptome, and metabolome analyses of the hepatopancreas of Litopenaeus vannamei under cold stress. Comp Biochem Phys D. 2024;49:101196.
Stincone A, Prigione A, Cramer T, Wamelink MMC, Campbell K, Cheung E, et al. The return of metabolism: biochemistry and physiology of the pentose phosphate pathway. Biol Rev Camb Philos Soc. 2015;90:927–63.
Phang JM. Proline metabolism in cell regulation and cancer biology: recent advances and hypotheses. Antioxid Redox Sign. 2019;30:635–49.
Elia I, Broekaert D, Christen S, Boon R, Radaelli E, Orth MF, et al. Proline metabolism supports metastasis formation and could be inhibited to selectively target metastasizing cancer cells. Nat Commun. 2017;8:15267.
Funding
This work was supported by grants from the National Natural Science Foundation of China (No. 32172946), the Young Elite Scientists Sponsorship Program by CAST (2022QNRC001), the Shanghai Rising-Star Program (2022) and the Fundamental Research Funds for the Central Universities, ECNU.
Author information
Authors and Affiliations
Contributions
Methodology, Software, Data analysis, Writing—Original Draft, Writing—Review & Editing, MXW; Methodology, Writing—Review & Editing, YXY; Conceptualization, Methodology, Software, WL; Conceptualization, Software, JQF; Methodology, Writing—Review & Editing, ECL; Methodology, Writing—Review & Editing, LQC; Conceptualization, Writing—Review & Editing, Project administration, XDW. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
Animal care and treatment procedures were carried out in strict accordance with the ethical requirements of the Animal Experiment of East China Normal University (permit number: E20120101).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Wang, M., Yan, Y., Liu, W. et al. Proline metabolism is essential for alkaline adaptation of Nile tilapia (Oreochromis niloticus). J Animal Sci Biotechnol 15, 142 (2024). https://doi.org/10.1186/s40104-024-01100-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s40104-024-01100-w