Skip to main content

Table 2 Primers used for real-time quantitative PCRa

From: The optimal dietary arginine level of laying hens fed with low-protein diets

Geneb Genebank accession no. Orientation Sequences (5′ to 3′) Product size, bp
CAT1 NM_001145490.1 Forward GCTCTATGGTGTTGGAGGG 192
Reverse AATAAGCCACAAAGCAGATGAG
b0,+AT NM_001199133.1 Forward TGTGTTGCTCTCTAACTGGCTG 154
Reverse CCTCCTTTCTGTTGTCCTGTTC
y+LAT1 XM_418326.5 Forward TCCTGGTCATAGTTCCTCTCTACA 243
Reverse CAATGTCAAGGCAACCCTAC
rBAT XM_004935370.2 Forward TTGGCTTGGCAAAGGAGTC 146
Reverse TCGGAATAGGCTGTGATGCT
B0AT XM_419056 Forward AATGGGACAACAAGGCTCAG 125
Reverse CAAGATGAAGCAGGGGGATA
EAAT3 XM_424930 Forward ACCCTTTTGCCTTGGAAACT 122
Reverse TTGAGATGTTTGCGTGAAG
PepT1 NM_204365 Forward ACACGTTTGTTGCTCTGTGC 122
Reverse GACTGCCTGCCCAATTGTAT
GAPDH NM_204305.1 Forward ACATGGCATCCAAGGAGTGAG 144
Reverse GGGGAGACAGAAGGGAACAGA
  1. aPCR = Polymerase chain reaction
  2. bCAT-1, Cationic amino acid transporter-1; b0,+AT, b0,+ amino acid transporter; y+LAT1, y+L amino acid transporter-1; rBAT, Related to b0,+ amino acid transporter; B0AT, B0 neutral amino acid transporter; EAAT3, Acidic amino acids transporter; PepT1, Intestinal peptide transporter-1