Skip to main content

Table 3 qPCR primer sequence

From: Dietary calcium supplementation promotes the accumulation of intramuscular fat

Gene Sequence(5'→3')
MyOG F: AGGAAGTCTGTGTCGGTGGA
R: AGGCGCTCAATGTACTGGAT
MyHC F: GAATGGCAAGACGGTGACTGTG
R: GGAAGCGTAGCGCTCCTTGAG
MEF2C F: ACCAGGACAAGGAATGGGAG
R: GGCGGCATGTTATGTAGGTG
TNNI1 F: ATGCCGGAAGTTGAGAGGAA
R: CTGAAGGGCACTGAGAGACA
PGC-1α F: AGCCTCTTTGCCCAGATCTT
R: GGCAATCCGTCTTCATCCAC
TNNC1 F: GCAAGGTGATGAGGATGCTG
R: GACTTCCCTTTGCTGTCGTC
MYH1 F: GGACCCACGGTCGAAGTTG
R: CCCGAAAACGGCCATCT
MYH4 F: CAATCAGGAACCTTCGGAACAC
R: GTCCTGGCCTCTGAGAGCAT
TNNC2 F: CGGCTCCATCGACTTTGAAG
R: AGCAGCTCATCGATCTCCTC
TNNI2 F: GATGAGGAGAAGCGCAACAG
R: TTTCTCCTCTTCAGCCACGT
β-actin F: CAGCCTTCCTTCTTGGGTAT
R: TGGCATAGAGGTCTTTACGG
  1. MyOG Myogenin, MyHC Myosin Heavy Chain, MEF2C Myocyte Enhancer Factor 2C, TNNI1 Troponin I1 Slow Skeletal Type, PGC-1α PPARG Coactivator 1 alpha, TNNC1 Troponin C1 Slow Skeletal and Cardiac Type, MYH1 Myosin Heavy Chain 1, MYH4 Myosin Heavy Chain 4, TNNC2 Troponin C2 Fast Skeletal Type, TNNI2 Troponin I2 Fast Skeletal Type.