Skip to main content

Table 2 Primers used for real-time PCR analysisa

From: Effects of age on immune function in broiler chickens

Gene nameb Primer sequence (5′ to 3′) Accession number
GAPDH F:AGAACATCATCCCAGCGTCC NM_204305
R:CGGCAGGTCAGGTCAACAAC
MHC-II F:CCACGGACGTGATGCAGAAC 113,206,149
R:ACCGCGCAGGAACACGAAGA
Mucin 2 F:TTCATGATGCCTGCTCTTGTG XM_421035
R:CCTGAGCCTTGGTACATTCTTGT
Lyz C F:GACGATGTGAGCTGGCAG NM_205281
R:GGATGTTGCACAGGTTCC
pIgR F:ATTTGTCACCACCACAGCCA NM_001044644
R:GAGTAGGCGAGGTCAGCATC
IgA F:ACCACGGCTCTGACTGTACC S40610.1
R:CGATGGTCTCCTTCACATCA
NF-κB F:TGGAGAAGGCTATGCAGCTT NM_205134.1
R:CATCCTGGACAGCAGTGAGA
IL-2 F:AGTGCACCCAGCAAACTCTG NM_204153.1
R:TCCGGTGTGATTTAGACCCGT
IL-4 F:GCTCTCAGTGCCGCTGATG NM_0010079.1
R:GAAACCTCTCCCTGGATGTCAT
IL-6 F:GATCCGGCAGATGGTGATAA NM_204628.1
R:AGGATGAGGTGCATGGTGAT
IFN-γ F:AAAGCCGCACATCAAACACA NM_205149.1
R:GCCATCAGGAAGGTTGTTTTTC
TGF-β1 F:GCCGACACGCAGTACACCAAG NM_001318456.1
R:GCAGGCACGGACCACCATATTG
CD3d F:TGTTGTCGCCACTGTCTTGCTG NM_205512.1
R:GTCCATCATTCCGCTCACCAAGG
CD4 F:GATGGAGAGGTGTGGAGCAG NM_204649
R:CCTCCTTTCCTGCAATCCCA
TCR β subunit F:ACTGGTATGCCTGGCCTCTGG M81149.1
R:CCACTCCTTCTGTCCTCTTCACAC
TCR ζ subunit F:AGCTTAGCCAGGCCTCTGAA AJ002317.1
R:GGTGCCCAGCACATCGTATT
  1. aPrimers designed using Primer Express software (Sangon Biotech, Shanghai, China)
  2. bAbbreviations: GADPH glyceraldehyde-3-phosphate dehydrogenase, MHC-II major histocompatibility complex II, Lyz C lysozyme C, pIgR polymeric immunoglobulin receptor, IgA immune globulin A, NF-κB nuclear factor kappa-β, TGF-β1 transforming growth factor-β1, IL-2 interleukin-2, IFN-γ interferon-γ, TCR β submit T cell receptor β submit