Skip to main content

Table 2 Sequences of primers used for quantitative real-time PCR

From: Modulations of genes related to gut integrity, apoptosis, and immunity underlie the beneficial effects of Bacillus amyloliquefaciens CECT 5940 in broilers fed diets with different protein levels in a necrotic enteritis challenge model

Gene Accession No Sequence (5'→3') Size, bp Annealing T, °C Reference
CASP3 NM_204725.1 F-TGGTGGAGGTGGAGGAGC
R- GTTTCTCTGTATCTTGAAGCACCA
110 62 This study
CASP8 NM_204592.2 F-GGAGCTGCTATCGGATCAAT
R-GGAGCTGCTCTATCGGATCAAT
126 60 This study
IgA S40610.1 F- GTCACCGTCACCTGGACACCA
R- ACCGATGGTCTCCTTCACATC
192 64 [33]
IgG X07174.1 F- ATCACGTCAAGGGATGCCCG
R- ACCAGGCACCTCAGTTTGG
118 60 [34]
IgM X01613.1 F- GCATCAGCGTCACCGAAAGC
R- TCCGCACTCCATCCTCTTGC
98 60 [34]
MUC2 XM 001234581.3 F- CCCTGGAAGTAGAGGTGACTG
R- TGACAAGCCATTGAAGGACA
143 60 [35]
OCLD NM_205128.1 F- ACGGCAGCACCTACCTCAA
R- GGGCGAAGAAGCAGATGAG
123 60 [36]
TJP1 XM_413773.4 F- GGATGTTTATTTGGGCGGC
R- GTCACCGTGTGTTGTTCCCAT
187 60 [37]
CLDN1 NM_001013611.2 F- CTTCATCATTGCAGGTCTGTCAG
R- AAATCTGGTGTTAACGGGTGTG
103 60 [37]
IL18 NM_204608.1 F- TGTGTGTGCAGTACGGCTTAG
R- CTTACAAAAGGCATCGCATTC
79 60 [38]
Il-2 NM_204153.1 F- TCTGGGACCACTGTATGCTCT
R- ACACCAGTGGGAAACAGTATCA
256 60 [39]
IFN-y Y07922 F- AGCTGACGGTGGTGGACCTATTATT
R- GGCTTTGCGCTGGATTC
259 60 [40]
ATP1A1 NM_205521.1 F- GTCAACCCGAGGGATGCTAA
R- ACTGCTACAATGGCACCCTG
179 60 [41]
B0AT XM_419056.5 F- GTGTTTGGAACCCTAAATACGAGG
R- TAGCATAGACCCAGCCAGGA
72 60 [41]
GLUT2 NM_207178.1 F- TGATCGTGGCACTGATGGTT
R- CCACCAGGAAGACGGAGATA
171 60 [41]
SI XM_015291762.1 F- GCTTTAAGATGGGCAAGAGGAAG
R- CCACCACCAGGCAAAAGAGG
65 60 [41]
HMBS XM 417846.2 F- GGCTGGGAGAATCGCATAGG
R- TCCTGCAGGGCAGATACCAT
131 60 [42]
YWHAZ NM_001031343.1 F- TTGCTGCTGGAGATGACAAG
R- CTTCTTGATACGCCTGTTG
61 60 [43]