Skip to main content

Table 2 Primers used for real-time quantitative PCR

From: Tannic acid prevents post-weaning diarrhea by improving intestinal barrier integrity and function in weaned piglets

Gene Accession No. Primer sequences (5′→3′) Size, bp
ZO-1 XM_005659811.1 F: CAGCCCCCGTACATGGAGA 114
R: GCGCAGACGGTGTTCATAGTT
ZO-2 NM_001206404.1 F: ATTCGGACCCATAGCAGACATAG 90
R: GCGTCTCTTGGTTCTGTTTTAGC
OCLN NM_001163647.2 F: CTACTCGTCCAACGGGAAAG 158
R: ACGCCTCCAAGTTACCACTG
CLDN-1 NM_001258386.1 F: GCCACAGCAAGGTATGGTAAC 140
R: AGTAGGGCACCTCCCAGAAG
CLDN-2 NM_001161638.1 F: GCATCATTTCCTCCCTGTT 156
R: TCTTGGCTTTGGGTGGTT
GAPDH NM_001206359.1 F: TGAAGGTCGGAGTGAACGGAT 114
R: CACTTTGCCAGAGTTAAAAGCA
  1. ZO-1 Zonula occluden 1, ZO-2 Zonula occluden 2, OCLN Occludin, CLDN-1 Claudin 1, CLDN-2 Claudin 2, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, F Forward, R Reverse