Skip to main content

Table 1 Primer sequences for realtime PCR

From: Heat exposure impairs porcine oocyte quality with suppressed actin expression in cumulus cells and disrupted F-actin formation in transzonal projections

Target genes Primer sequences (5′ to 3′) Products, bp GenBank No.
18S F: CCCACGGAATCGAGAAAGAG
R: TTGACGGAAGGGCACCA
122 AY265350.1
PPIA F: GACTGAGTGGTTGGATGG
R: TGATCTTCTTGCTGGTCTT
116 NM_214353.1
β-actin F: CATCACCATCGGCAACGA
R: GCGTAGAGGTCCTTCCTGATGT
144 XM_021086047.1
γ-actin F: TCAGCAAGCAGGAGTACGAC
R: GAGGTGTGTACATTTGCCAGG
140 XM_003357928.4
COX1 F: TGGTGCCTGAGCAGGAATAGTG
R: ATCATCGCCAAGTAGGGTTCCG
88 KF888634.1
COX2 F: GCTTCCAAGACGCCACTTCAC
R: TGGGCATCCATTGTGCTAGTGT
154 KF888634.1
COX3 F: GGCTACAGGGTTTCACGGGTTG
R: TCAGTATCAGGCTGCGGCTTCA
130 KF888634.1
ND1 F: TCCTACTGGCCGTAGCATTCCT
R: TTGAGGATGTGGCTGGTCGTAG
165 KF888634.1
ND2 F: ATCGGAGGGTGAGGAGGGCTAA
R: GTTGTGGTTGCTGAGCTGTGGA
191 KF888634.1
ND3 F: AGCACGCCTCCCATTCTCAAT
R: TGCTAGGCTTGCTGCTAGTAGG
172 KF888634.1
ND4 F: TCGCCTATTCATCAGTAAGTCA
R: GGATTATGGTTCGGCTGTGTA
174 KF888634.1
ND5 F: CGGATGAGAAGGCGTAGGAA
R: GCGGTTGTATAGGATTGCTTGT
103 KF888634.1
ND6 F: ACTGCTATGGCTACTGAGATGT
R: CTTCCTCTTCCTTCAACGCATA
124 KF888634.1
ND4L F: GATCGCCCTTGCAGGGTTACTT
R: CTAGTGCAGCTTCGCAGGCT
182 KF888634.1
ATP6 F: ACTCATTCACACCCACCACACA
R: CCTGCTGTAATGTTGGCTGTCA
232 KF888634.1
ATP8 F: TGCCACAACTAGATACATCC
R: GCTTGCTGGGTATGAGTAG
107 KF888634.1
CYTB F: CTGAGGAGCTACGGTCATCACA
R: GCTGCGAGGGCGGTAATGAT
162 KF888634.1