Skip to main content

Table 2 Primers used for real-time PCR analysisa

From: In vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens

Gene name Primer sequence (5′ to 3´) Product size, bp Efficiency, % Accession number
CAT-1 F: ATGTAGGTTGGGATGGAGCC 280 113.556 XM_015277949.1
R: AACGAGTAAGCCAGGAGGGT    
CAT-2 F: CAAGTCTTCTCGGCTCTAT 105 105.602 XM_015285435.1
R: GTGCCTGCCTCTTACTCA    
CAT-3 F: CAAGACTGGCTCTGCCTACC 236 106.623 XM_015278426.1
R: GGATCAACGCAAAGAAGTCC    
iNOS F: TGGGTGGAAGCCGAAATA 241 103.087 NM_204961.1
R: GTACCAGCCGTTGAAAGGAC    
ARG2 F: GCCAACTGTACGACTTTGGAG 150 90.430 NM_001199704.1
R: AGCTGTGTCCAGCAGCTACC    
ADC F: CCCAGTTTGAGGAGATTGCT 122 108.230 XM_004947849.2
R: AAAGGTGAAGGCTGAGGTGA    
AGAT F: TCGTCAAGAGGCCTGATCCA 140 111.489 XM_015291975.1
R: CCAAGCCATAGGCGCTTCAA    
IL-1β F: ACTGGGCATCAAGGGCTA 131 104.419 XM_015297469.1
R: GGTAGAAGATGAAGCGGGTC    
IL-6 F: CGCCCAGAAATCCCTCCTC 152 101.974 XM_015281283.1
R: AGGCACTGAAACTCCTGGTC    
IL-8 F: ATGAACGGCAAGCTTGGAGCTG 233 119.885 NM_205498.1
R: TCCAAGCACACCTCTCTTCCATCC    
IFN-γ F: AGCTGACGGTGGACCTATTATT 259 108.556 NM_205149.1
R: GGCTTTGCGCTGGATTC    
IL-10 F: CGCTGTCACCGCTTCTTCA 88 98.435 NM_001004414.2
R: TCCCGTTCTCATCCATCTTCTC    
TGF-β3 F: CATCGAGCTCTTCCAGATCC 112 102.986 NM_205454.1
R: GACATCGAAGGACAGCCACT    
JAK1 F: TGCACCGTGACTTAGCAGCAAG 168 114.087 XM_015290965.1
R: TCTGAATCAAGCATTCTGGAGCATACC   
JAK2 F: TCGCTATGGCATTATTCG 197 110.029 XM_015280061.1
R: GTGGGGTTTGGTCCTTTT    
JAK3 F: GCATCCGCCGCCGTGTTG 108 96.164 NM_204996.3
R: AGCACCGCAGCCTCTCCAG    
STAT1 F: TAAAGAGGGAGCAATCAC 112 109.954 XM_015289392.1
R: ATCAGGGAAAGTAACAGC    
STAT6 F: GCAACCTCTACCCCAACA 127 101.256 XM_015274736.1
R: TCCCTTTCGCTTTCCACT    
GAPDH F: TGCTGCCCAGAACATCATCC 142 98.200 NM_204305.1
R: ACGGCAGGTCAGGTCAACAA    
  1. aAbbreviations: CAT Cationic amino acid transporter, iNOS inducible nitric oxide synthase, ARG2 Arginase 2, ADC Arginine decarboxylase, AGAT Arginine: glycine amidinotransferase, IFN-γ Interferon-γ, TGF-β3 Transforming growth factor-β3, JAK Janus kinase, STAT Signal transducer and activator of transcription, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, F Forward, R Reverse