Skip to main content

Table 1 Primer sequences for qRT-PCR and the plasmid construction

From: Chicken gga-miR-1306-5p targets Tollip and plays an important role in host response against Salmonella enteritidis infection

Name Primer sequence (5′ →3′) Accession number Purpose
gga-miR-1306-5p F: gACCACCTCCCCTGCAA NR-035019 qRT-PCR
R: CAGTGCGTGTCGTGGAGT
Tollip F: ATGATCGCATTGCTTGGACA NM-001006471 qRT-PCR
R: AAAGACGTGTATGACATCACC
NF-κB F: TGACCGCCAATAGCTTGTCC NM-205129 qRT-PCR
R: ACAGCTAAATGCAATGCCGTTC
IL-6 F: TTCGACGAGGAGAAATGCCT NM-204628 qRT-PCR
R: CGACGTTCTGCTTTTCGCTAT
IL-1β F: TGGGCATCAAGGGCTACAAG NM-204524 qRT-PCR
R: CCAGGCGGTAGAAGAAGATGAAG
β-action F: GAGAAATTGTGCGTGACATCA NM-205518 qRT-PCR
R: CCTGAACCTCTCATTGCCA
gga-5 s-rRNA F: CCATACCACCCTGGAAACGC NR-046276 qRT-PCR
R: TACTAACCGAGCCCGACCCT
Tollip F: TCGCTCGAGGCCACCATGAATCACTTCCTGCGTTGT NM-001006471 Cloning
R: CCAGCGGCCGCGATGACCACCCGTTTTAT