Skip to main content

Table 3 Primer sequences used for RT-qPCR

From: Dietary supplementation with free methionine or methionine dipeptide mitigates intestinal oxidative stress induced by Eimeria spp. challenge in broiler chickens

Gene Primer sequences (5′ → 3′) Amplicon, bpa Accession No.
SOD1 b F: AGATGGCAGTGGGAAATGAG 110 NM_205064.1
R: ACTCAAGACAGCAGAGTAGTAATG   
CAT F: GAGGAACCCTCAGACTCATTTG 117 NM_001031215.2
R: CCATCAGGAATACCACGATCAC   
PEPT1 F: CCCCTGAGGAGGATCACTGTT 66 KF366603.1
R: CAAAAGAGCAGCAGCAACGA   
y + LAT-1 F: TGTTGGAGCCAGAGAAGGA 118 XM_418326.6
R: CACAAGGAGATAAAGCAAAGTC   
B 0 AT1 F: TCTATTGAAGATTCGGGCAC 153 XM_419056.6
R: AATGGTAAGCACAAGGTATGG   
CAT - 1 F: CGTGGCATCTCTGCTCATC 134 NM_001145490.1
R: CTCCATCCCAACCTACATACTTA   
TLR2 F: ACTGCCTGCAACGGTCAT 75 NM_204278.1
R: CATCAGCTTCATTGTTGGTTTCTGT   
TLR5 F: ACACGGCAATAGTAGCAACACATAT 91 XM_025148815.1
R: ACACCTGGAACTTGGAAAAGAACAT   
IL1B F: GTCAACATCGCCACCTACAA 90 XM_015297469.1
R: CGGTACATACGAGATGGAAACC   
IL2 F: CCTCAAGAGTCTTACGGGTCTA 104 GU119890.1
R: AGTTGGTCAGTTCATGGAGAAA   
IFNG F: TGAGGTGATGTTTACCGAGTTT 94 NM_205149.1
R: GCTTAGAGCTGAGCAGGTATG   
LITAF F: GAGCGTTGACTTGGCTGTC 64 NM_204267.1
R: AAGCAACAACCAGCTATGCAC   
CLDN1 F: ACTCCTGGGTCTGGTTGGT 100 AY750897.1
R: GACAGCCATCCGCATCTTCT   
OCLN F: ACGGCAGCACCTACCTCAA 123 D21837.1
R: GGGCGAAGAAGCAGATGAG   
iNOS F: TCCTGAGTTCTGTGCCTTTG 92 U46504.1
R: GTTCATCTCCTTCACCCACTG   
ACTB F: GCCAACAGAGAGAAGATGAC 130 L08165.1
R: CACCAGAGTCCATCACAATAC   
  1. abp Base pairs
  2. bSOD1 Superoxide dismutase 1 gene, CAT Catalase gene, PEPT1 Peptide transporter 1 gene, y+LAT-1 Neutral and cationic amino acid transporter 1 gene, B0AT1 System B0 neutral amino acid transporter 1 gene, CAT–1 Cationic amino acid transporter 1 gene, TLR2 Toll-like receptor 2 gene, TLR5 Toll-like receptor 5 gene, IL1B Interleukin 1 beta gene, IL2 Interleukin 2 gene, IFNG Interferon gamma gene, LITAF Lipopolysaccharide-induced tumor necrosis factor-alpha factor gene, CLDN1 Claudin-1 gene, OCLN Occludin gene, iNOS Inducible nitric oxide synthase gene, F Forward, R Reverse