Skip to main content

Table 2 Primers used for real-time qPCR

From: Surplus dietary isoleucine intake enhanced monounsaturated fatty acid synthesis and fat accumulation in skeletal muscle of finishing pigs

Genea Primers Primer sequences (5′→3′) Size, bp Tm, °C Accession No.
ADD1 Forward GCGACGGTGCCTCTGGTAGT 218 60 XM_021066226.1
FABP4 Forward TGGAAACTTGTCTCCAGTG 147 54 NM_001002817.1
FAS Forward GCCTAACTCCTCGCTGCAAT 195 60 NM_001099930.1
SCD Forward GCCTACTATCTGCTGAGTGC 152 57 XM_021072070.1
GAPDH Forward TCGGAGTGAACGGATTTG 219 60 NM_001206359.1
  1. aADD1 Adipocyte determination and differentiation factor 1, FABP4 Fatty acid binding protein 4, FAS Fatty acid synthase, HSL Hormone sensitive lipase, LPL Lipoprotein lipase, SCD Stearoyl-CoA desaturase, GAPDH Glyceraldehyde-3-phosphate dehydrogenase