Skip to main content

Advertisement

Table 3 RT-PCR Primer sequences of target and reference genes

From: Effects of dietary Clostridium butyricum supplementation on growth performance, intestinal development, and immune response of weaned piglets challenged with lipopolysaccharide

Genes Primer sequence (5′→3′) Product, bp GenBank No.
TLR2 F:TCGAAAAGAGCCAGAAAACCAT 58 NM213761
R:CTTGCACCACTCGCTCTTCA  
TLR4 F:AGAAAATATGGCAGAGGTGAAAGC 64 GQ304754
R:CTTCGTCCTGGCTGGAGTAGA  
NF-κB F:TGCTGGACCCAAGGACATG 60 AK348766.1
R:CTCCCTTCTGCAACAACACGTA  
IL-6 F:GATGCTTCCAATCTGGGTTCA 62 M80258.1
R:CACAAGACCGGTGGTGATTCT  
IL-10 F: GCCTTCGGCCCAGTGAA 71 NM214041.1
R: AGAGACCCGGTCAGCAACAA  
TNF-α F: TCTATTTTGGGATCATTGCCC 127 NM214022.1
R: CCAGCCCCTCATTCTCTTTCT  
β-actin F:GGCGCCCAGCACGAT 66 DQ845171.1
R:CCGATCCACACGGAGTACTTG