Skip to main content

Table 2 Primer sequences for quantitative real-time polymerase chain reaction

From: Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs

Genea Primer sequence (5′→3′) Size, bp Accession No.
MUC1 Forward: GTGCCGCTGCCCACAACCTG
Reverse: AGCCGGGTACCCCAGACCCA
141 XM_001926883.4
MUC2 Forward: GGTCATGCTGGAGCTGGACAGT
Reverse: TGCCTCCTCGGGGTCGTCAC
181 XM_013989745.1
MUC4 Forward: GATGCCCTGGCCACAGAA
Reverse: TGATTCAAGGTAGCATTCATTTGC
89 XM_001926442.1
BAX Forward: CTGACGGCAACTTCAACTGG
Reverse: CGTCCCAAAGTAGGAGAGGA
200 XM_003127290.4
BCL2 Forward: AGCATGCGGCCTCTATTTGA
Reverse: GGCCCGTGGACTTCACTTAT
120 XM_003121700.2
FAS Forward: TGATGCCCAAGTGACTGACC
Reverse: GCAGAATTGACCCTCACGAT
103 NM_213839.1
caspase-3 Forward: GTGGGACTGAAGATGACA
Reverse: ACCCGAGTAAGAATGTG
190 NM_214131.1
caspase-8 Forward: AGACAAGGGCATCATCATCGG
Reverse: GGTTTACCAAGAAGGGAACGG
102 NM_001031779.2
caspase-9 Forward: AATGCCGATTTGGCTTACGT
Reverse: CATTTGCTTGGCAGTCAGGTT
195 XM_003127618.4
GAPDH Forward: ATGGTGAAGGTCGGAGTGAAC
Reverse: CTCGCTCCTGGAAGATGGT
235 NM_001206359.1
  1. aMUC1, mucin 1; MUC2, mucin 2; MUC4, mucin 4; BAX, B-cell lymphoma-2-associated X protein; BCL2, B-cell lymphoma-2; caspase-3, cysteinyl aspartate-specific proteinase-3; caspase-8, cysteinyl aspartate-specific proteinase-8; caspase-9, cysteinyl aspartate-specific proteinase-9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase