Skip to main content

Advertisement

Table 3 Primer sequences for RT-qPCR

From: Vitamin A administration at birth promotes calf growth and intramuscular fat development in Angus beef cattle

Gene Forward primer sequence (5′→3′) Reverse primer sequence (5′→3′) Access number Product length, bp
ZFP423 GGATTCCTCCGTGACAGCA TCGTCCTCATTCCTCTCCTCT NM_001101893.1 120
PPARG AGCTCCAAGAATACCAAAGTGCGAT AGGTTCTTCATGAGGCCTGTTGTAGA NM_181024.2 98
ADH4 AGAAAATGGGCACCAAGGGAA TTCATTGCTGAGGGGCTTGT NM_001102059.2 80
ADH5 TTGAGATGACTGACGGGGGA CTCCCACTACCACGCTGATG NM_001034249.2 117
ALDH1A1 GGAAATGGTCGAGAACTGGGA GGAGGGCTTGGGTGTCATAG NM_174239.2 299
GAPDH TGCCCGTTCGACAGATAGCC GCGACGATGTCCACTTTGCC NM_001034034.2 148
β−atenin CGGCTTTCGGTTGAGCTGAC GCCGTACCCACCAGAGTGAA XM_005222525.3 159
18S rRNA CCTGCGGCTTAATTTGACTC AACTAAGAACGGCCATGCAC NR_036642.1 118