Skip to main content

Advertisement

Table 2 List of primers used in this study

From: Ileum terminal antibiotic infusion affects jejunal and colonic specific microbial population and immune status in growing pigs

Bacteria Forward primer, 5′→3’ Reverse primer, 5′→3’ Reference Annealing temp, °C
Total bacteria GTGSTGCAYGGYYGTCGTCA ACGTCRTCCMCNCCTTCCTC [63] 60
Bacteroides-Prevotella GAGAGGAAGGTCCCCCAC CGCTACTTGGCTGGTTCAG [64] 60
Bifidobacterium TCGCGTCYGGTGTGAAAG GGTGTTCTTCCCGATATCTACA [65] 60
Clostridium cluster IV GCACAAGCAGTGGAGT CTTCCTCCGTTTTGTCAA [66] 60
Clostridium cluster XIVa CGGTACCTGACTAAGAAGC AGTTTYATTCTTGCGAACG [67] 60
Escherichia coli CATGCCGCGTGTATGAAGAA CGGGTAACGTCAATGAGCAAA [68] 60
Lactobacillus AGCAGTAGGGAATCTTCCA ATTCCACCGCTACACATG [69] 60