Skip to main content

Advertisement

Table 1 Real-time PCR primers sequences for the target genes

From: Interferon-γ acts as a regulator in the trade-off between phagocytosis and production performance in dwarf chickens

Genea Accession No. Primer Sequencesb (5′→3′) Product size, bp Temperature, °C
GAPDH NM_204305.1 F: CTGAGAACGGGAAACTTGTG 105 60
R: CCACAACATACTCAGCACCTG
FSH-β NM_204257.1 F: AGCAGTGGAAAGAGAAGAATGTGA 151 60
R: TGTTTCATACACAACCTCCTTGAAG
IFNGR1 NM_001130387.1 F: AACCTGAGCATCCCAGTTCC 135 60
R: ACTCCAAGCCTGCGTGATAG
IFNGR2 NM_001008676.2 F: GCACCGGAGGATGTAATGGT 145 60
R: GGGTGCAGTCCATCTCACTC
  1. aGAPDH glyceraldehyde-3-phosphate dehydrogenase, FSH-β follicle stimulating hormone beta subunit, IFNGR1 interferon gamma receptor 1, IFNGR2 interferon gamma receptor 2
  2. bF, forward; R, reverse