Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR

From: Endoplasmic reticulum stress-induced apoptosis in intestinal epithelial cells: a feed-back regulation by mechanistic target of rapamycin complex 1 (mTORC1)

Gene Accession No. Primers (5′→3′) Product size, bp
ATF4 NM_024403.2 F: GCCAAGCACTTCAAACCTCA R: CAATCTGTCCCGGAAAAGGC 125
HSPA5 NM_013083.2 F: TGATATCGGAGGTGGGCAAA R: CTTTCCCAAATACGCCTCGG 100
XBP1s NM_001004210.2 F: ACAGACTGCGCGAGATAGAA R: ATCCCCAAGCGTGTCCTTAA 165
DDIT3 XM_006241444.2 F: GTCACAAGCACCTCCCAAAG R: ACTGACCACTCTGTTTCCGT 115
β-actin NM_031144.3 F: TGTGTTGTCCCTGTATGCCT R: CCCTCATAGATGGGCACAGT 90