Skip to main content

Advertisement

Table 2 Primers for the genes of milk protein

From: Regulation of amino acid transporters in the mammary gland from late pregnancy to peak lactation in the sow

Gene name Accession number Primers (5'→3') Size, bp
CSN1S1 NM_001004029 F: ACAAATGAGGACAAGCATACCC 175
R: GAGGGATGTTGGTGAATAATGG
CSN1S2 NM_001004030 F: GAAGTGGGATATGCCAGCAG 148
R: CCTGGAGATATTGGGGGAAC
CSN2 NM_214434 F: TCATCCTTGCCTGCTTCGT 367
R: GGCATTCCTTTACGCTTGG
CSN3 NM_001004026 F: GCCTATCCTGGCATTAACACTG 286
R: TGGGTAGACATTTGGCTGGTC
  1. Abbreviation: CSN1S1 αS1-casein, CSN1S2 αS2-casein, CSN2 β-casein, CSN3 κ-casein