Skip to main content

Table 2 Species-specific primers for the quantification of selected rumen bacterial populations using a real-time qPCR assay

From: Rumen-protected methionine during the peripartal period in dairy cows and its effects on abundance of major species of ruminal bacteria

Target bacterial species   Primer sequence (5' → 3') Reference
Anaerovibrio lipolytica F:a GAAATGGATTCTAGTGGCAAACG [12]
Butyrivibrio proteoclasticus F: GGGCTTGCTTTGGAAACTGTT [12]
Eubacterium ruminantium F: CTCCCGAGACTGAGGAAGCTTG [37]
Fibrobacter succinogenes F: GCGGGTAGCAAACAGGATTAGA [37]
Megaspheara elsdenii F: AGATGGGGACAACAGCTGGA [37]
Prevotella bryantii F: AGCGCAGGCCGTTTGG [37]
Selenomonas ruminantium F: CAATAAGCATTCCGCCTGGG [37]
Succinimonas amylolytica F: CGTTGGGCGGTCATTTGAAAC [29]
Succinivibrio dextrinosolvens F: TAGGAGCTTGTGCGATAGTATGG [29]
Bacteria general 1 F: GGATTAGATACCCTGGTAGT [20]
Bacteria general 2 F: GTGSTGCAYGGYTGTCGTCA [19]
  1. aF forward primer; bR reverse primer