Skip to main content

Advertisement

Table 2 Primers of target genes for RT-PCR

From: Betaine affects muscle lipid metabolism via regulating the fatty acid uptake and oxidation in finishing pig

Genes GenBank accession Primers sequences(5′ to 3′) Product size, bp Annealing temperature, °C
β-actin XM_003124280.3 CCTGCGGCATCCACGAAAC 123 63
   TGTCGGCGATGCCTGGGTA   
AMPKα2 AY159788.1 GGTCTGGTTCCTCAACACCTCA 90 63
   GGCTCTCCGCAGTGACAGAAT   
PPARγ NM_214379 GTGGAGACCGCCCAGGTTTG 108 64
   GGGAGGACTCTGGGTGGTTCA   
LPL NM_214286.1 CCCTATACAAGAGGGAACCGGAT 138 63
   CCGCCATCCAGTCGATAAACGT   
CPT1 NM_001007191.1 GGACGAGGAGTCTCACCACTATGAC 128 63
   TCTTGAACGCGATGAGGGTGA   
FATP1 NM_001083931.1 CCCTCTGCGTCGCTTTGATG 151 63
   GCTGCGGTCCCGGAAATACA   
FAT/CD36 NM_001044622.1 CTGGTGCTGTCATTGGAGCAGT 160 63
   CTGTCTGTAAACTTCCGTGCCTGTT   
FABP3 NM_001099931.1 CCAACATGACCAAGCCTACCACA 176 63
   ACAAGTTTGCCTCCATCCAGTGT   
PPARα NM_001044526.1 GGCTTACGGCAATGGCTTCA   
   CGGTCTCCGCACCAAATGA 168 64