Skip to main content

Table 2 Primers used for quantification in this study

From: Long-term effects of early antibiotic intervention on blood parameters, apparent nutrient digestibility, and fecal microbial fermentation profile in pigs with different dietary protein levels

Target Primer sequence 5′→3′ Reference
Total bacteria Forward: CGGTGAATACGTTCYCGG
Reverse: GGWTACCTTGTTACGACTT
[38]
Firmicutes Forward: GGAGYATGTGGTTTAATTCGAAGCA [39]
Reverse: AGCTGACGACAACCATGCAC
Bacteroidetes Forward: GGARCATGTGGTTTAATTCGATGAT [39]
Reverse: AGCTGACGACAACCATGCAG
Clostridium IV Forward: GCACAAGCAGTGGAGT [40]
Reverse: CTTCCTCCGTTTTGTCAA
Clostridium XIVa Forward: CGGTACCTGACTAAGAAGC [41]
Reverse: AGTTTYATTCTTGCGAACG
E.coli Forward: CATGCCGCGTGTATGAAGAA [42]
Reverse: CGGGTAACGTCAATGAGCAAA
Lactobacillus Forward: AGCAGTAGGGAATCTTCCA [43]
Reverse: ATTCCACCGCTACACATG