Skip to main content

Table 3 List of primer sequences used for quantitative reverse transcription polymerase chain reaction

From: Regulatory elements and transcriptional control of chicken vasa homologue (CVH) promoter in chicken primordial germ cells

  Primer sequence (5′ → 3′)  
No. Gene Symbol Description Accession No. Forward Reverse Product Size, bp
2 GABPA GA binding protein transcription factor, alpha subunit 60 kDa NM_001007858.1 TGAACAGGTGACACGATGGG GGGACTCGCTGGAAGAAGTC 225
3 HSF2 heat shock transcription factor 2 NM_001167764.1 CCAGTTATCACCTGGAGCC CCAACAAGTCCTCTCGACCC 242
4 NFYA nuclear transcription factor Y, alpha NM_001006325.1 TCAGCCACCTGTGAAGACAC TCGAACTGGGCTTTCACCTC 231
6 ZNF143 zinc finger protein 143 XM_004941377.1 GAAGCGGCACATCCTTACCT CCCTGACTTCCACAGCGATT 216