Skip to main content

Advertisement

Table 1 List of primer sequences used for cloning of the CVH promoter

From: Regulatory elements and transcriptional control of chicken vasa homologue (CVH) promoter in chicken primordial germ cells

Primer sets Primer sequence (5′ → 3′)
CVH −1,575 bp_F GACACAGCTTTCCCACGTGAG
CVH −1,231 bp_F TGGCCACGTGCTATCATATTAGT
CVH −625 bp_F CTCTGATCATGCCTGCAGCC
CVH −316 bp_F CAGGACAGGCCTAGGGACAGA
CVH −227 bp_F AGCATAAACAGGGAAAGCGC
CVH −135 bp_F GCGCCACCTTCTCACCCC
CVH +25 bp_F GCTATTTGGAGCGGAGAGTGAAA
CVH promoter_R AGCGAATGCCAGCAGCC
CVH −135/+222_R CGCCCTGACGCCACCAT
CVH −135/+162_R AGCACGCACTGCCCTTGC
eGFP poly A _F ACTAGTCCGCGGATGGTGAGCAAG
eGFP poly A_R CATATGGACGTCTCCCCAGCATGCC