Skip to main content

Table 2 Primers used for qPCR analysis of immune cytokines

From: Short-term effect of supplemental yeast extract without or with feed enzymes on growth performance, immune status and gut structure of weaned pigs challenged with Escherichia coli lipopolysaccharide

Genea GenBank reference no. Amplicon size, bp Tm b, °C Primer sequence (5′→3′)
IFN-γ NM_213948.1 231 60 F: GGCCATTCAAAGGAGCATGG
R: GCTCTCTGGCCTTGGAACAT
IL-1β NM_214055.1 131 60 F: GCCCATCATCCTTGAAACGTG
R: GGAGAGCCTTCAGCATGTGT
IL-6 NM_214399.1 149 60 F: TAAGGGAAATGTCGAGGCCG
R: TCCACTCGTTCTGTGACTGC
IL-10 NM_214041.1 179 60 F: TCCGACTCAACGAAGAAGGC
R: AACTCTTCACTGGGCCGAAG
TNF-α NM_214022.1 120 60 F: ATTCAGGGATGTGTGGCCTG
R: CCAGATGTCCCAGGTTGCAT
β-actin XM_005670976.1 179 60 F: CGAGGCTCAGAGCAAGAGAG
R: GGTTGGCCTTAGGGTTCAGG
  1. a IFN-γ interferon gamma, TNF-α tumor necrosis factor-α, IL interleukin
  2. bAnnealing temperature