Skip to main content

Advertisement

Table 2 Primers used for quantitative real-time PCR

From: Modified halloysite nanotubes reduce the toxic effects of zearalenone in gestating sows on growth and muscle development of their offsprings

Gene GenBank Accession number Primer sequence (5’→3’)a Amplicon length, bp
β-actin AY_550069 FP: ATGCTTCTAGGCGGACTGT RP: CCATCCAACCGACTGCT 211
IGF-I NM_214256 FP: CTGTGCTTGCTCTCCTTCAC RP: TACCCTGTGGGCTTGTTGA 128
IGF-II NM_213883 FP: GTGGCATCGTGGAAGAGTG RP: GTGGCATCGTGGAAGAGTG 166
Pax7 XM_005659088 FP: CCACATCCGCCACAAGATAG RP: ATGCCTGGGTTCTCCCTCT 162
Myf-5 NM_001278775 FP: CCAGCCTCTCTCTCTCCAGTT RP: GCCTCCTTCCTCCTGTGTAATA 151
MyoD1 NM_001002824 FP: AGCGGACGACTTCTATGATGAC RP: GTGTTCCTCGGGCTTTAGG 112
Mstn NM_001012406 FP: TGGTATTTGGCAGAGCATTGAT RP: CCTGGGAAGGTTACAGCAAGAT 129 
  1. a FP forward primer, RP reverse primer