Skip to main content

Advertisement

Table 2 Primers used for quantitative real-time PCR

From: Modified halloysite nanotubes reduce the toxic effects of zearalenone in gestating sows on growth and muscle development of their offsprings

Gene GenBank Accession number Primer sequence (5’→3’)a Amplicon length, bp
β-actin AY_550069 FP: ATGCTTCTAGGCGGACTGT
RP: CCATCCAACCGACTGCT
211
IGF-I NM_214256 FP: CTGTGCTTGCTCTCCTTCAC
RP: TACCCTGTGGGCTTGTTGA
128
IGF-II NM_213883 FP: GTGGCATCGTGGAAGAGTG
RP: GTGGCATCGTGGAAGAGTG
166
Pax7 XM_005659088 FP: CCACATCCGCCACAAGATAG
RP: ATGCCTGGGTTCTCCCTCT
162
Myf-5 NM_001278775 FP: CCAGCCTCTCTCTCTCCAGTT
RP: GCCTCCTTCCTCCTGTGTAATA
151
MyoD1 NM_001002824 FP: AGCGGACGACTTCTATGATGAC
RP: GTGTTCCTCGGGCTTTAGG
112
Mstn NM_001012406 FP: TGGTATTTGGCAGAGCATTGAT
RP: CCTGGGAAGGTTACAGCAAGAT
129 
  1. a FP forward primer, RP reverse primer