Skip to main content

Advertisement

Table 1 Primer and probe sequences used in our study

From: A direct real-time polymerase chain reaction assay for rapid high-throughput detection of highly pathogenic North American porcine reproductive and respiratory syndrome virus in China without RNA purification

Name Sequence 5′→3′ Location (GenBank no.) Product
dHP-PRRSV-F GGGTCGGCACCAGTTCC 1555-1571 (FJ495082.2) 73 bp
dHP-PRRSV-R AATCCAGAGGCTCATCCTGGT 1607-1627 (FJ495082.2)
dHP-PRRSV-pro FAM-CACCGCGTATAACTGTGACAACAACGC-BHQ1 1574-1600 (FJ495082.2)