Skip to main content

Table 2 PCR primers and probes used in this study for TaqManqRT-PCR analysis

From: Quantitative analysis of ruminal methanogenic microbial populations in beef cattle divergent in phenotypic residual feed intake (RFI) offered contrasting diets

Primer/Probe Sequence (5’→3’) Efficiency Product size, bp Reference
Msmithii F CCGGGTATCTAATCCGGTTC    Dridi et al., 2009 [19]
Msmithii R CTCCCAGGGTAGAGGTGAAA 1.98 123 Dridi et al., 2009 [19]
Msmithii probe CCGTCAGAATCGTTCCAGTCAG    Dridi et al., 2009 [19]
Mruminantium F CCGGGTATCTAATCCGGTTC    Dridi et al., 2009 [19]
Mruminantium R CTCCCAGGGTAGAGGTGAAA 2.02 123 Dridi et al., 2009 [19]
Mruminantium probe CCGTCAGGTTCGTTCCAGTTAG    Current study