Skip to main content

Advertisement

Table 1 Primers used in RT-PCR analysis

From: Effect of diacylglycerol acyltransferase 2 overexpression in 3T3-L1 is associated to an increase in mono-unsaturated fatty acid accumulation

Gene GenBank access no. Sequence (5’→3’) Product, bp
HSL U08188.1 F: AGTGCCTATTCAGGGACAGA 184
R: TGGGCGATGTGGTCTTTT
ACACA AY451393 F: GACAGAGGAAGATGGCGTCC 172
R: TACAACTTCTGCTCGCTGGG
a-FABP NM_024406.2 F: GCTCATAGCACCCTCCTG 93
R: TCCAGGTTCCCACAAAGG
LPL NM_008509.2 F: ACTGCCACTTCAACCACACC 211
R: GCCACATCATTTCCCACC
ATGL NM_025802.3 F: GACCTGATGACCACCCTTTC 169
R: GGCTACCCGTCTGCTCTTT
DGAT2 NM_001160080.1 F: GGCTCAATAGGTCCAAGGTA 96
R: GGGCGTGTTCCAGTCAAA
SCD1 NM_009127.4 F: GCTCTACACCTGCCTCTTC 103
R: CCGTGCCTTGTAAGTTCTG
β-actin NM_007393.3 F: TAAGGCCAACCGTGAAAAGATGAC 422
R: ACCGCTCGTTGCCAATAGTGATG
PPARγ NM_001127330.1 F: TCAAGGGTGCCAGTTTCGC 232
R: GGGCTTCCGCAGGCTTTT
FASN NM_007988.3 F: CCAAGACTGACTCGGCTACT 280
R: GCCAGGTTCGGAATGCTAT
FAT/CD36 NM_001159556.1 F: CTGTGGGCTCATTGCTGG 214
   R: CGCCACGTCATCTGGGTTT