Skip to main content

Table 1 Primer sequences for the target genes

From: In ovo leptin administration affects hepatic lipid metabolism and microRNA expression in newly hatched broiler chickens

Target genes GenBank accession numbers PCR products (bp) Primer sequences
β-actin NM 205518 300 F: 5′- tgcgtgacatcaaggagaag -3′
    R: 5′- tgccagggtacattgtggta -3′
LEPR NM 204323 87 F: 5′- gcatctctgcatctcaggaaaga -3′
    R: 5′- gcaggctacaaactaacagatcca -3′
SREBP-1c NM 204126 104 F: 5′- gcagaagagcaagtccctcaa -3′
    R: 5′- tcggcatctccatcacctc -3′
SREBP-2 XM 416222 108 F: 5′- cccagaacagcaagcaagg -3′
    R: 5′- gcgaggacaggaaagagagtg -3′
HMGCR AB 109635 137 F: 5’-ttggatagagggaagagggaag -3’
    R: 5’- ccatagcagaacccaccaga-3’
CYP7A1 AB 109636 106 F:5’- cattctgttgccaggtgatgtt -3’
    R:5’- gctctctctgtttcccgcttt -3’