Skip to main content

Table 1 The primers sequences for RT-PCR

From: Constant light in early life induces fear-related behavior in chickens with suppressed melatonin secretion and disrupted hippocampal expression of clock- and BDNF-associated genes

Target genes Primer sequences (5’ to 3′)
clock F: GATCACAGGGCACCTCCAATA R: CTAGTTCTCGCCGCCTTTCT
baml1 F: GTAGACCAGAGGGCGACAG R: ATGAAACTGAACCAGCGACTC
cry1 F: GATGTGGCTATCCTGTAGTTCCT R: GCTGCTGGTAGATTTGTTTCAT
cry2 F: GCACGGCTGGATAAACACT R: AAATAAGCGGCAGGACAAA
per2 F: ATGAAACGAGCCATCCCG R: CAGTTGTCGTGATTTTGCCTA
per3 F: CAGTGCCTTTGTTGGGTTAC R: GATGGATTCACAAAACTGGAC
rorα F: GGGGATGTCTCGAGATGCTG R: TGCTTTGCTACCTTCAGGGG
rev-erbα F: CAGCGGTTTCCAGTCATCCT R: TCACTCTTTGGTGCCCCATC
5-hta F: AGAACACGGAGGCCAAGC R: ACGGCAACCAGCAGAGGA
5-htb F: CACGGACCACGTCCTCTACAC R: TTTCTTTGGCGTCTGCTTCA
maoa F: ATTCCTCCTGAAGCACCAT R: CACTGCCTCACATACCAC
maob F: AGGCTGGAGAAAAAGCAGCA R: CCCGGTACAGATGGCAAGTT
nrf2 F: GGCCACCCTAAAGCTCCATT R: GGCTTCACTGAACTGCTCCT
keap1 F: TCAACTGGGTGCAGTACGAC R: TCTGCGCCAGGTAATCCTTG
sod1 F: GAGCGGGCCAGTAAAGGTTA R: CCCTTTGCAGTCACATTGCC
sod2 F: TACAGCTCAGGTGTCGCTTC R: GCGAAGGAACCAAAGTCACG
nqo1 F: CGCACCCTGAGAAAACCTCT R: AAGCACTCGGGGTTCTTGAG
cat F: GCGCCCCGAACTATTATCCA R: ATACGTGCGCCATAGTCAGG
gctc F: GGACGCTATGGGGTTTGGAA R: AGGCCATCACAATGGGACAG
gpx1 F: CTGCAACCAATTCGGGCAC R: CACCTCGCACTTCTCGAACA
gpx2 F: CGCCAAGTCCTTCTACGACC R: GGTGTAATCCCTCACCGTGG
gpx3 F: CGAAAGTACGCGGGGAAGAT R: GGACGACAAGTCCATAGGGC
bdnf F: GACATGGCAGCTTGGCTTAC R: GTTTTCCTCACTGGGCTGGA
trκb F: TGACTGTGGTGGATTCAGGC R: TGGCGAAAAGGCTTCTTGGA
dcx F: GCAGCTGCCACAGGTAGTAA R: ACTGCTTGGATTTGGGCGTA
ppia F: TTACGGGGAGAAGTTTGCCG R: TGGTGATCTGCTTGCTCGTC