Skip to main content

Table 3 The sequences of primers specific to the analyzed genes expression in the longissimus thoracis muscle of lambs

From: Dietary Coleus amboinicus Lour. decreases ruminal methanogenesis and biohydrogenation, and improves meat quality and fatty acid composition in longissimus thoracis muscle of lambs

Gene name Primer sequence (5′ to 3′) Reference
Forward Reverse
SCD GAGTACCGCTGGCACATCAA CTAAGACGGCAGCCTTGGAT [25]
ELOVL5 TGCTTCAGTTTGTGCTGACC TGGTCCTTCTGGTGCTCTCT [25]
FASN GGAGGACGCTTTCCGTTACA TGCTCTTCCTCACGTACCTGAA [25]
FADS1 CTGCTGTACCTGCTGCACAT ACGGACAGGTGTCCAAAGTC [25]
LPL TCATCGTGGTGGACTGGCT CATCCGCCATCCAGTTCATA [25]
  1. Analyzed expression of five genes: SCD stearoyl-CoA desaturase, ELOVL5 fatty acid elongase 5, FADS1 fatty acid desaturase 1, FASN fatty acid synthase and LPL lipoprotein lipase