Skip to main content

Table 2 The sequences of primers specific to the analyzed bacteria species

From: Dietary Coleus amboinicus Lour. decreases ruminal methanogenesis and biohydrogenation, and improves meat quality and fatty acid composition in longissimus thoracis muscle of lambs

Species Primer sequences (5′ to 3′) Reference
Streptococcus bovis F: TTCCTAGAGATAGGAAGTTTCTTCGG [17]
R: ATGATGGCAACTAACAATAGGGGT
Ruminococcus flavefaciens F:CGAACGGAGATAATTTGAGTTTACTTAGG [18]
R: CGGTCTCTGTATGTTATGAGGTATTACC
Ruminococcus albus F: CCCTAAAAGCAGTCTTAGTTCG [19]
R: CCTCCTTGCGGTTAGAACA
Megasphaera elsdenii F: AGATGGGGACAACAGCTGGA [17]
R: CGAAAGCTCCGAAGAGCCT
Prevotella spp. F: GAAGGTCCCCCACATTG [17]
R:CAATCGGAGTTCTTCGTG
Lactobacillus spp. F: TATGGTAATTGTGTGNCAGCMGCCGCGGTAA [20]
R: AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT
Fibrobacter succinogenes F: GTTCGGAATTACTGGGCGTAAA [21]
R: CGCCTGCCCCTGAACTATC
Butyrivibrio proteoclasticus F: TCCTAGTGTAGCGGTGAAATG [22]
R: TTAGCGACGGCACTGAATGCCTA
Butyrivibrio fibrisolvens F: ACACACCGCCCGTCACA [23]
R: TCCTTACGGTTGGGTCACAGA
Anaerovibrio lipolytica F: GAAATGGATTCTAGTGGCAAACG [24]
R:ACATCGGTCATGCGACCAA