Skip to main content

Table 2 Sequences of primers

From: Alterations in intestinal microbiota composition coincide with impaired intestinal morphology and dysfunctional ileal immune response in growing-finishing pigs under constant chronic heat stress

Gene Accession No. Primer sequence (5′to 3′) Product size, bp Annealing temperature, °C
β-Actin XM_003124280.4 F: CACGCCATCCTGCGTCTGGA
R: AGCACCGTGTTGGCGTAGAG
380 60
TLR-2 NM_213761.1 F: TCACTTGTCTAACTTATCATCCTCTTG
R: TCAGCGAAGGTGTCATTATTGC
162 60
TLR-4 NM_001113039.2 F: GCCATCGCTGCTAACATCATC
R: CTCATACTCAAAGATACACCATCGG
108 60
TNF-α NM_214022.1 F: CGTCGCCCACGTTGTAGCCAAT
R: GCCCATCTGTCGGCACCACC
128 62
IL-6 NM_001252429.1 F: TGGCATCTGCCTTCCCTACC
R: CAGAGATTTTGCCGAGGATG
132 60
IL-8 NM_213867.1 F: TTCGATGCCAGTGCATAAATA
R: CTGTACAACCTTCTGCACCCA
176 60
  NM-001204296.1 F: ACACCCATGGGCGCTATGT
R: GCCTGCAGAAACCTGCTCAT
68 55.7
  XM-007465997.1 F: CTGCTCCGGGTCCTGTGGGA
R: CCCGCTGGCTGGTGCGATAC
100 59
PG1–5 XM_005669497.2 F: GTAGGTTCTGCGTCTGTGTCG
R: CAAATCCTTCACCGTCTACCA
166 60
pBD-2 AY506573.1 F: CCAGAGGTCCGACCACTACA
R: GGTCCCTTCAATCCTGTTGAA
88 59
  1. Abbreviations: F Forward, R Reverse; TLR-2, toll-like receptor 2; TLR-4, toll-like receptor 4; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; IL-8, interleukin-8; PG1–5, protegrin 1–5; pBD-2, porcine beta-defensin 2