Skip to main content

Table 3 Antioxidant related and protein degradation related genes’ primers used for quantitative polymerase chain reaction analysis

From: Dietary Enteromorpha polysaccharide-Zn supplementation regulates amino acid and fatty acid metabolism by improving the antioxidant activity in chicken

Gene name Accession No. Primer (5' to 3')
mTOR XM_417614.2 F: GGTGATGACCTTGCCAAACT
R: CTCTTGTCATCGCAACCTCA
Antioxidant related
NRF2 NM_205117.1 F: GAGAAAGCCTTGCTGGCTCA
R: TGAAGTATCTGTGCTCTGCGAA
CAT NM_001030762.3 F: GCGCCCCGAACTATTATCCA
R: ATACGTGCGCCATAGTCAGG
SOD1 NM_205064.1 F: GGCAATGTGACTGCAAAGGG
R: ATGCAGTGTGGTCCGGTAAG
SOD2 NM_204211.1 F: TACAGCTCAGGTGTCGCTTC
F: GCGAAGGAACCAAAGTCACG
GSH-PX1 NM_001277853.2 F: TGCGCCCGATGTTTTCAAAG
R: AACGTTACCCAGACTCACGG
GSH-PX4 NM_001346448.1 F: GGGTGAAGTTCGACATGTTCAG
R: GTTCCACTTGATGGCATTCCC
Protein degradation related genes
 μ-Calpain NM_205303 F: CACACAAGGAGGCCGACTTC
R: TCCGCTGTGTCTGACTGCTT
 20S proteasome C1 subunit AB_001935 F: TGAGGAACAAGGAGCCCATCT
R: TGCCCTTGTACTGATACACCATGT
 m-Calpain large subunit D_38026 F: GTGGCTCGGTTTGCTGATG
R: AATCAAGCACCGGACACAATT
 Caspase 3 AF_083029 F: GGAACACGCCAGGAAACTTG
R: TCTGCCACTCTGCGATTTACA
 Cathepsin B U_18083 F: GCTACTCGCCTTCCTACAAGGA
R: GCGAGGGACACCGTAGGAT
Atrogin1/MAFbx XM_418451 F: CCAACAACCCAGAGACCTGT
R: GGAGCTTCACACGAACATGA