Skip to main content

Table 2 Amino acid transporter and lipid metabolism-related genes’ primers used for a quantitative polymerase chain reaction

From: Dietary Enteromorpha polysaccharide-Zn supplementation regulates amino acid and fatty acid metabolism by improving the antioxidant activity in chicken

Gene name Accession No. Primer (5' to 3')
Amino acid transporter
SLC7A1/ CAT1 EU360441.1 F: CGAACAACAGAGGAGACAGATAA
R: GGGACACAGTATGGCTTTGA
SLC43A2/ LAT4 XM 415803.4 F: GACTCGCAGCATCCCTAAAT
R: GTGTCAGAGAAGTGGACGATATG
SLC7A5/ LAT1 NM_001030579.1 F: GATTGCAACGGGTGATGTGA
R: CCCCACACCCACTTTTGTTT
SLC1A4/ ASCT1 XM_001232899.2 F: TTGGCCGGGAAGGAGAAG
R: AGACCATAGTTGCCTCATTGAATG
SLC1A1/ EAAT3 XM_424930 F: ACCCTTTTGCCTTGGAAACT
R: TTGAGATGTTT GCGTGAAG
SLC6A19/ B0AT XM_419056 F: TGCGTAGGGTTTTGTGTTGG
R: AACTCCAGACT CCCACACTG
Lipid metabolism
ACC1 NM_205505 F: AATGGCAGCTTTGGAGGTGT
R: TCTGTTTGGGTGGGAGGTG
FADS1 NC_006092.4 F: TCACTTGTGGAGGTAAGCATC
R: GGCGAGAAAGGAGAGGAGTC
SREBP1c AY029224 F: GCCCTCTGTGCCTTTGTCTTC
R: ACTCAGCCATGATGCTTCTTCC
PPARα AF163809 F: AGACACCCTTTCACCAGCATCC
R: AACCCTTACAACCTTCACAAGCA
SCD1 NM_205064.1 F: TTGTCTGATGGAGATCATGGCTTC
R: TGCTTGCCTTCAGGATTAAAGTGAG
CPT-1 AY675193 F: GGGACCTGAAACCAGAGAACG
R: ACAGAGGAGGGCATAGAGGATG
ACOX1 NM_001012578 F: GCCAGGTGGACTTGGAAAGA
R: GCTGCCGTATAGGAACAATGAAG
FABP1 NM_204192.3 F: AGAAGGCCAAGTGTATTGTTAACAT
R: GTGATGGTGTCTCCGTTGAGTTC
 β-actin NM 205518.1 F: ACCGGACTGTTACCAACACC
R: CCTGAGTCAAGCGCCAAAAG