Skip to main content

Table 2 List of gene primer sequences a

From: Soya saponin improves egg-laying performance and immune function of laying hens

Gene name Prime sequence(5' to 3') Product size, bp
GnRH1 F GGCTCAACACTGGTCTTATGG 202
R TCTTCTGGCTTCTCCTTCG
ERR F GTACGGCTCTACTACACTCAGTTATGC 160
R CTGCTGGCTGTGGTGATGGATG
PGR F GTGTCGCTTGAGGAAGTGCTGTC 116
R CGGCTGGCTGCTGAAGTGC
LHR F CGTCCTCATAACCAGCCACTACAAG 119
R TCTGAGCATCCACCGAAGCAATG
FSHR F GTCTCACCTGCTTGCTGATTCTCC 99
R CCTTGATCTCCTGGCAGATGAATATCC
PPAR-γ F TCCTTCCCGCTGACCAAA 212
R TCCTGCACTGCCTCCACA
TNF-α F GAGCGTTGACTTGGCTGTC 64
R AAGCAACAACCAGCTATGCAC
IL-1β F ACTGGGCATCAAGGGCTA 131
R GGTAGAAGATGAAGCGGGTC
IFN-γ F AGCTGACGGTGGACCTATTATT 259
R GGCTTTGCGCTGGATTC
IL-4 F AGACAAATAACAAAACTGAGC 212
R TTGGTGGAAGAAGGTACG
NF-κB F GTGTGAAGAAACGGGAACTG 203
R GGCACGGTTGTCATAGATGG
Caspase1 F CGGCCAGCGCCATCTTCATT 347
R AGGGAGCTGTCACAGTGCGT
IL-12 F AAGGTGCAGAAGCAGAGGAC 88
R TTGTGTTGCTCTGACTGTTGG
TGF-β F TCATCACCAGGACAGCGTTA 109
R TGTGATGGAGCCATTCATGT
β-actin F GAGAAATTGTGCGTGACATCA 152
R CCTGAACCTCTCATTGCCA
  1. aPrimers designed using Primer Express software (Sangon Biotech, Shanghai, China)