Skip to main content

Table 2 Primers used for the real-time quantitative PCR

From: Natural astaxanthin enhanced antioxidant capacity and improved semen quality through the MAPK/Nrf2 pathway in aging layer breeder roosters

Genes Primer sequence (5′ → 3′) Fragment length, bp Annealing temperature, °C Accession number
ACTB Forward: GCCAACAGAGAGAAGATGACAC 118 58 NM_205518
Reverse: GTAACACCATCACCAGAGTCCA
SOD1 Forward: TTGTCTGATGGAGATCATGGCTTC 98 58 NM_205064
Reverse: TGCTTGCCTTCAGGATTAAAGTGAG
SOD2 Forward: CAGATAGCAGCCTGTGCAAATCA 86 58 NM_204211.1
Reverse: GCATGTTCCCATACATCGATTCC
CAT Forward: ACCAAGTACTGCAAGGCGAAAGT 91 58 NM_001031215.2
Reverse: ACCCAGATTCTCCAGCAACAGTG
GPX-1 Forward: TTCGAGAAGTTCCTCGTGGG 79 58 NM_0012778553.2
Reverse: CCTGCAGTTTGATGGTCTCG
GPX-4 Forward: TCAACCGTGAGGGCCAAGT 100 58 NM_001346448.1
Reverse: CTCGGCACGCAGCTCTAC
Nrf2 Forward: ACATGGACAGTTCTCCTGGG 92 58 NM_205117.1
Reverse: CGGCTCCACAGAAGGAAGTA
ERK Forward: AGCAAGCTTTAGCCCATCCA 108 58 NM_204150.1
Reverse: CCTTCGGCAAGTCATCCAAT
JNK1 Forward: GGGTGCATTATGGGCGAAAT 108 58 XM_421650.2
Reverse: TTCTGGGCACGGTGTTCCTA
JNK2 Forward: AGCAGCCTCGATGCCTTGAC 110 58 AB000807.1
Reverse: CAAGCAATTCAGGCCCAATG
JNK3 Forward: CTGGTGAGTGAGCTGATGGA 82 58 NM_001318224.3
Reverse: ACAGCAGGTAGGACATTCGT
p38 Forward: TGTGTTCACCCCTGCCAAGT 149 58 AJ719744.1
Reverse: GCCCCCGAAGAATCTGGTAT