Skip to main content

Table 1 Bisulfite-converted DNA PCR primers

From: Dynamic changes of genomic methylation profiles at different growth stages in Chinese Tan sheep

Primers name Primer sequence (5′ to 3′)
KRT71-F GTATAGTGGGGAAGAGGTTTTTATAG
KRT71-R CCACACAAAATCACACAACTAATCAA
KRT71-S AATCACACAACTAATCAAC
CD44-F AATGATGGATGTAGAATAATTTAATTGTTT
CD44-R ACAACCTCAATCTTAAAAATACTATAAC
CD44-S ATTTTATAGATTTGAATATAATTTG
ROR2-F GGGGTTATAAAATAGATGGATATGATTTAG
ROR2-R TTTTTAACAACTCCTCCTTTATCTCT
ROR2-S AGTAGTTTTTATAATTTTGTTTGAG
ZDHHC13-F AGGTTGGTGTAAAAGTAATTGT
ZDHHC13-R CATAACCACATTTATTTAAAAATATATTCC
ZDHHC13-S TGTGGTTTTGTATTGTTGA
  1. Note: F represents forward primers; R represents reverse primers; S represents sequencing primers