Skip to main content

Table 2 Sequence of primers used for qPCR

From: Beneficial effects of a decreased meal frequency on nutrient utilization, secretion of luteinizing hormones and ovarian follicular development in gilts

Genes Forward Reverse
β-ACTIN GGCCGCACCACTGGCATTGTCAT AGGTCCAGACGCAGGATGGCG
FSHR TCACAGTCCCTCGGTTCCTT AGCATCACAGCCTGCTCCA
LHCGR ATGGGGCTCTACCTGCTACTCA GAGCCACCCTCCAAGCATAA
GDF9 CTCTGCCTCTTCCTCCTCCACTG GGTGAATGAGTACGGTGCTCTTGG
BMP15 ACCATGCCATCATTCAGAGCCTTG CGTTGGTCTCAATCAGGAGGATGC
CYP11A1 GGCTCCAGAGGCCATAAAGA ACTCAAAGGCGAAGCGAAAC
STAR GACTTTGTGAGTGTCGGCTGTA ATCCCTTGAGGTCAATGCTG
3β-HSD CACTGACCTGGGCTGATGAC GTGGCGAGAAGCAGACAAGA
CYP17A1 TCCAAGCCAAGACGAAC TTTACCACAGAGGCAGAAG
  1. Abbreviations: FSHR follicle-stimulating hormone receptor, LHCGR luteinizing hormone/chorionic gonadotropin receptor, GDF9 growth differentiation factor 9, BMP15 bone morphogenetic protein 15, CYP11A1 cytochrome P450 family 11 subfamily A member 1, STAR steroidogenic acute regulatory protein, 3βHSD 3 β-hydroxysteroid dehydrogenase, CYP17A1 cytochrome P450 family 17 subfamily A member 1