Skip to main content

Table 3 List of primer sequences used for quantitative real-time PCR

From: Differential transcriptional regulation of the NANOG gene in chicken primordial germ cells and embryonic stem cells

Gene symbol Primer sequence (5′ → 3′)
Forward Reverse
CEBPA CCCACCTGCAGTACCAGATC TCTTTTTGGATTTGCCGCGG
CEBPB CGCCCGCCTTTAAATCCATG GGGCTGAAGTCAATGGCTCT
CEBPD ACTTCTACGACGCCAAGGTG CTCTCGTCCTCGTACATGGC
CEBPG CCCACAGCTAACGTGTCAGT GGACGGGCTCTTCTTTGACA
CEBPZ CGCTGTTCACAGTCTCCACT GGACGCTGTGAGAAAGACCA
SOX2 AAACCGAGCTGAAACCTCCC TGTGCATCTTCGGGTTCTCC
SOX3 CGGCTCAGCAGACTCGATAC TCGCCGTGGCTTAAGAACTT
POU5F3 TGAAGGGAACGCTGGAGAGC ATGTCACTGGGATGGGCAGAC
TP53 CCGTGGCCGTCTATAAGAAA ACAGCACCGTGGTACAGTCA
NANOG AGTGGCAGAGTCTGGGGTAT ACTACTACTGGCCCTCTCCG
GAPDH GGTGGTGCTAAGCGTGTTAT ACCTCTGTCATCTCTCCACA