Skip to main content

Table 1 List of primer sequences used to clone the NANOG promoter

From: Differential transcriptional regulation of the NANOG gene in chicken primordial germ cells and embryonic stem cells

Primer name Primer sequence (5′ → 3′)
cNANOG − 3550 bp_F AAGCTTTGTCCTTTTCTTGACC
cNANOG − 3375 bp_F CTGGAGTCAAGGGCTGTGG
cNANOG − 3154 bp_F TGGGCCCCTCGTTACAGCT
cNANOG − 2928 bp_F CCAGCAGTACAAGCTCCGAA
cNANOG − 1988 bp_F GCGACACGTGGAACA
cNANOG − 945 bp_F CATGGGGGTGTCTGCTC
cNANOG − 627 bp_F CTTCTTTGTGCTCCTCC
cNANOG − 442 bp_F CTGCAGTCTGCAATGC
cNANOG − 407 bp_F AATGTCCCGGGGGGGTCTCTGG
cNANOG − 377 bp_F CCATTCTTTGTACTTGGGTGGGGACCGATGAG
cNANOG − 312 bp_F CGAGGGCGGGGGTGCCAGCCCAG
cNANOG − 250 bp_F CTGCAGTCTGCTCCTCC
cNANOG − 210 bp_F CTGCAGTCTGCAATGC
cNANOG − 170 bp_F CCAAAGGGGGAAGCTGC
cNANOG − 130 bp_F ACTCTCCGAATATCCCCATAGC
cNANOG − 69 bp_F TCGTGACAATCTCTTG
cNANOG promoter_R GGTCGGGACGACACCT