Skip to main content

Table 1 Primer sequences of the genes analyzed

From: Transcription factor EB (TFEB)-mediated autophagy protects bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro

Gene Primer sequences (5′→3′) Length, bp Efficiency (E%)
TFEB F TGCTGACCCCAGATCCAACT
R CCCAAACCTGCTTGATCACC
76 101
β-actin F GCCCTGAGGCTCTCTTCCA
R GCGGATGTCGACGTCACA
101 97
GAPDH F GTCTTCACTACCATGGAGAAGG
R TCATGGATGACCTTGGCCAG
197 103
  1. The efficiency was determined as [E = (10–1/slope−1) × 100%]