Skip to main content

Table 3 Primer and probe sequences used for real-time PCR

From: Dietary seaweed-derived polysaccharides improve growth performance of weaned pigs through maintaining intestinal barrier function and modulating gut microbial populations

Items Primer and probe sequence (5´→3´) Product length, bp
Total bacteria F: ACTCCTACGGGAGGCAGCAG
R: ATTACCGCGGCTGCTGG
200
Lactobacillus F: GAGGCAGCAGTAGGGAATCTTC
R: CAACAGTTACTCTGACACCCGTTCTTC
126
P: AAGAAGGGTTTCGGCTCGTAAAACTCTGTT  
Bifidobacterium F: CGCGTCCGGTGTGAAAG
R: CTTCCCGATATCTACACATTCCA
121
P: ATTCCACCGTTACACCGGGAA  
Bacillus F: GCAACGAGCGCAACCCTTGA
R: TCATCCCCACCTTCCTCCGGT
92
P: CGGTTTGTCACCGGCAGTCACCT  
Escherichia coli F: CATGCCGCGTGTATGAAGAA
R: CGGGTAACGTCAATGAGCAAA
96
P: AGGTATTAACTTTACTCCCTTCCTC