Skip to main content

Table 2 Nucleotide sequences of primers used to measure targeted genes (Exp. 2)

From: Dietary seaweed-derived polysaccharides improve growth performance of weaned pigs through maintaining intestinal barrier function and modulating gut microbial populations

Gene symbols Nucleotide sequence of primers (5´→3´) Product length, bp Accession No.
β-actin F: TCTGGCACCACACCTTCT
R: TGATCTGGGTCATCTTCTCAC
78 XM_021086047.1
TLR2 F: ACGTATCCATCAATGAACACTGC
R: AAGGGTGCAGTCATCAAACTC
146 NM_213761.1
TLR4 F: TCAGTTCTCACCTTCCTCCTG
R: GTTCATTCCTCACCCAGTCTTC
121 GQ503242.1
TLR6 F: TCTCATGGCACAGCGAACTT
R: ACATCATCCTCTTCAGCGACT
123 NM_213760.2
MyD88 F: GGTGCCAGGCAGGACATC
R: GGCAGCTGGAACAGACCAA
68 NM_001099923.1
IL-6 F: GACAAAGCCACCACCCCTAA
R: CTCGTTCTGTGACTGCAGCTTATC
69 M80258.1
IL-1β F: TCTGCCTGTACCCCAACTG
R: CCAGGAAGACGGGCTTTTG
63 NM214055.1
TNF-α F: CGTGAAGCTGAAAGACAACCAG
R: GATGGTGTGAGTGAGGAAAACG
121 EU682384.1
IL-10 F: GACCAGATGGGCGACTTGTT
R: TGCCTTCGGCATTACGTCTT
120 NM_214041.1
ZO-1 F: GAGGATGGTCACACCGTGGT
R: GGAGGATGCTGTTGTCTCGG
169 XM_021098896.1
Claudin-1 F: TCAATACAGGAGGGAAGCCAT
R: ATATTTAAGGACCGCCCTCTCC
91 NM_001244539.1
Occludin F: CAGGTGCACCCTCCAGATTG
R: TGGACTTTCAAGAGGCCTGG
111 NM_001163647.2
  1. TLR toll like receptor, MyD88 myeloid differentiation factor 88, IL-6 interleukin-6, IL-1β interleukin-1β, TNF-α tumor necrosis factor α, IL-10 interleukin-10, TGF-β1 transforming growth factor-β1, ZO-1 zonula occludens-1