Skip to main content

Table 1 Sequences of oligonucleotide primers used for qPCR

From: Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells

Target Primer Sequence (5′ to 3′) Size, bp
TLR2 Forward TCATCTCCCAAATCTGCGAAT 167
Reverse GGCTGATGTTCTGAATTGACCTC
TLR4 Forward CCGTCATTAGTGCGTCAGTTCT 100
Reverse TTGCAGCCCACAAAAAGCA
NLRP3 Forward AGCAGATTCCAGTGCATCAAAG 76
Reverse CCTGGTGAAGCGTTTGTTGAG
NLRP6 Forward TCAACCGCCTCTTCAGCC 116
Reverse CGCCCAGTCGTACAGGATTT
GAPDH Forward GAAGGTCGGAGTGAACGGAT 150
Reverse CATGGGTAGAATCATACTGGACA