Skip to main content

Table 1 Primers for real-time PCR analysesa

From: The protective roles of tea tree oil extracts in bovine mammary epithelial cells and polymorphonuclear leukocytes

GenePrimer sequence (5′ to 3′)Accession numberSize, bp
GAPDHF:GGGTCATCATCTCTGCACCTNM_001034034176
R:GGTCATAAGTCCCTCCACGA
IL-6F:TCCTTGCTGCTTTCACACTCNM_173923.2129
R:CACCCCAGGCAGACTACTTC
IL-1βF:CAGTGCCTACGCACATGTCTNM_174093.1209
R:AGAGGAGGTGGAGAGCCTTC
TNF-αF:GCCCTCTGGTTCAGACACTCNM_173966.3192
R:AGATGAGGTAAAGCCCGTCA
TLR-2F:CAGGCTTCTTCTCTGTCTTGTNM_174197.2140
R:CTGTTGCCGACATAGGTGATA
IL-8F:TGGGCCACACTGTGAAAATNM_173925.2136
R:TCATGGATCTTGCTTCTCAGC
κ-caseinF: CCAGGAGCAAAACCAAGAACNM_174294.2148
R: TGCAACTGGTTTCTGTTGGT
IL-10F:TGTATCCACTTGCCAACCAGNM_174088.1126
R:CAGCAGAGACTGGGTCAACA
L-selectinF:CTCTGCTACACAGCTTCTTGTAAACCNM_174182.1104
R:CCGTAGTACCCCAAATCACAGTT
IRAK1F: CCTCAGCGACTGGACATCCTNM_001040555.1103
R:GGACGTTGGAACTCTTGACATCT
NFKBIAF:GGGAGACCTGGCCTTCCTCNM 001045868.1101
R:CCAGAAGTGCCTCAGCGATT
TRAF6F:AGAACAGATGCCCAATCACTATGATNM_001034661.2100
R:GTGATTCCTCTGCATCTTTTCATG
LysozymeF:GAGAGATGTGAGCTTGCCAGAANM_001078159.1120
R:TGTAGCTTGTGTGTTGTAATTGCTTTC
SOD2F:GAGAAGGGTGATGTTACAGCTCAGANM_201527.2100
R:GGCTCAGATTTGTCCAGAAGATG
TLR-4F:GACCCTTGCGTACAGGTTGTNM_174198.6103
R:GGTCCAGCATCTTGGTTGAT
β-actinF:GACCCAGATCATGTTCGAGANM_173979.3145
R:CTCATAGATGGGCACCGTGT
  1. aAbbreviations: GAPDH Glyceraldehyde-3-phosphate dehydrogenase, IRAK1 Interleukin 1 receptor associated kinase 1, NFKBIA NFKB inhibitor alpha, TRAF6 TNF receptor associated factor 6, SOD2 superoxide dismutase 2, TLR-2 Toll like receptor 2, TLR-4 Toll like receptor 4, F Forward; R Reverse