Skip to main content

Table 2 Characteristics of the primers used for real-time PCR analysisa

From: Protective effects of taurine against muscle damage induced by diquat in 35 days weaned piglets

Genes Primer (from 5’to 3′) Size, bp Accession No.
CAT F: ACATGGTCTGGGACTTCTGG
R: TCATGTGCCTGTGTCCATCT
99 XM_021081498.1
Gpx4 F: TGTGGTTTACGGATTCTGG
R: CCTTGGGCTGGACTTTCA
181 NM_214407.1
HSP70 F: AGGTGCAGGTGAGCTACAAG
R: CTGCGAGTCGTTGAAGTAGG
158 NM_213766.1
SOD2 F: CCTACGTGAACAACCTGAAC
R: GATACAGCGGTCAACTTCTC
247 NM_214127.2
TFAM F: AGATGCTTATAGGGCAGACTGGCA
R: ACCTATGTATTGAACTGGCTGGCA
607 NM_001130211.1
MAFbx F: CCAGAGAGTCGGCAAGT
R: GAGGGTAGCATCGCACAAGT
374 NM_001044588
MuRF1 F: AGCACGAAGACGAGAAAATC
R: TGCGGTTACTCAGCTCAGTC
150 NM_001184756
GAPDH F: TCGGAGTGAACGGATTTGGC
R: TGACAAGCTTCCCGTTCTCC
189 NM_001206359.1
  1. aCAT, catalase; Gpx4, glutathione peroxidase 4; HSP70, heat shock protein 70; SOD2, superoxide dismutase 2; TFAM, mitochondrial transcription factor; MAFbx, muscle atrophy F-box; MuRF1, muscular ring finger protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase