Skip to main content

Table 2 Primer sequences used for real-time PCR assay

From: Comparison of the protective effects of resveratrol and pterostilbene against intestinal damage and redox imbalance in weanling piglets

Namea Genbankb Sequence (5′ → 3′)c Length, bp
NQO1 NM_001159613.1 CATGGCGGTCAGAAAAGCAC 135
  ATGGCATACAGGTCCGACAC  
HO1 NM_001004027.1 TGATGGCGTCCTTGTACCAC 71
  GACCGGGTTCTCCTTGTTGT  
SOD1 NM_001190422.1 AAGGCCGTGTGTGTGCTGAA 118
  GATCACCTTCAGCCAGTCCTTT  
SOD2 NM_214127.2 GGCCTACGTGAACAACCTGA 126
  TGATTGATGTGGCCTCCACC  
GPX1 NM_214201.1 CCTCAAGTACGTCCGACCAG 85
  GTGAGCATTTGCGCCATTCA  
GPX2 NM_001115136.1 CTGGACGGGGAGAAGGTAGA 107
  TTGAGTTGGGTGAAGTCCCG  
GPX3 NM_001115155.1 GTATGGAGCCCTCACCATCG 122
  TCAGTTCAACGTACTGGCCC  
GPX4 NM_214407.1 TGTGTGAATGGGGACGATGC 135
  CTTCACCACACAGCCGTTCT  
GSTA1 NM_214389.2 ACACCCAGGACCAATCTTCTG 199
  AGTCTCAGGTACATTCCGGG  
GAPDH NM_001206359.1 CCAAGGAGTAAGAGCCCCTG 125
  AAGTCAGGAGATGCTCGGTG  
ACTB XM_003124280.5 TGGAACGGTGAAGGTGACAG 176
  CTTTTGGGAAGGCAGGGACT  
  1. aACTB Beta actin, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, GPX1 Glutathione peroxidase 1, GPX2 Glutathione peroxidase 2, GPX3 Glutathione peroxidase 3, GPX4 Glutathione peroxidase 4, GSTA1 Glutathione S-transferase alpha 1, HO1 Heme oxygenase 1, NQO1 NAD(P)H quinone dehydrogenase 1, SOD1 Superoxide dismutase 1, SOD2 Superoxide dismutase 2
  2. bGenBank Accession Number
  3. cShown as the forward primer followed by the reverse primer